hello, i would like to transform a csv file which include dna sequences to fasta format, using r studio and the library biostring. The csv file has 4 columns, the name of the chromosome, the start and end of dna sequence and the strand (missing or +). What code should i use to transform this file.
Here's a fake example.
> starts <- floor(runif(10)*1e5)
> ends <- starts + 50
> d.f <- data.frame(chr = paste0("chr", 1:10), starts = starts, ends = ends, strand = c("*", "+")[sample(1:2, 10, TRUE)])
> d.f
chr starts ends strand
1 chr1 17882 17932 *
2 chr2 79746 79796 +
3 chr3 41976 42026 *
4 chr4 96256 96306 +
5 chr5 79374 79424 *
6 chr6 25500 25550 *
7 chr7 54683 54733 +
8 chr8 38826 38876 +
9 chr9 18686 18736 +
10 chr10 22916 22966 *
## Err, skipped a step
> gr <- GRanges(d.f$chr, IRanges(d.f$starts, d.f$ends), d.f$strand)
> gr
GRanges object with 10 ranges and 0 metadata columns:
seqnames ranges strand
<Rle> <IRanges> <Rle>
[1] chr1 17882-17932 *
[2] chr2 79746-79796 +
[3] chr3 41976-42026 *
[4] chr4 96256-96306 +
[5] chr5 79374-79424 *
[6] chr6 25500-25550 *
[7] chr7 54683-54733 +
[8] chr8 38826-38876 +
[9] chr9 18686-18736 +
[10] chr10 22916-22966 *
-------
seqinfo: 10 sequences from an unspecified genome; no seqlengths
> seqs <- getSeq(BSgenome.Hsapiens.UCSC.hg19, gr)
Error in .starfreeStrand(strand(names)) :
cannot mix "*" with other strand values
## URP can't use missing strand. Let's just get the forward strand
> gr <- GRanges(d.f$chr, IRanges(d.f$starts, d.f$ends))
> seqs <- getSeq(BSgenome.Hsapiens.UCSC.hg19, gr)
> seqs
DNAStringSet object of length 10:
width seq
[1] 51 GTGTGTGACAGGCTATATGCGCGGCCAGCAGACCTGCAGGGCCCGCTCGTC
[2] 51 TACAGCCCCTCCAAAAAACAAAGACAGTTGGGAAGGTGTCAAATGGAGGAT
[3] 51 NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
[4] 51 AGAGAAAGACTCCATCTCAAAAAAATAATAATAAAATAGATTTTGTAAGAA
[5] 51 TGGCCTCGGGTTAGTAAAGAAAGAAGGAAATGCAGCAGCCTATGACCAAGA
[6] 51 NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
[7] 51 CTGGCCAGGCTGAGGCCCACAGTGAGTTCGTGATAAGGTAGGACCAGAGCC
[8] 51 GGATGGGACAAGAAGAAGCTGGGCTGACAAGCCCAACATAGTGGAGCCAGC
[9] 51 GACGGTGCTGAGTTCCCTGCACTCTCAGAAGGGACAGGCCCTATGCTGCCA
[10] 51 NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
> writeXStringSet(seqs, "whatevs.fa")
> readLines("whatevs.fa")
[1] ">"
[2] "GTGTGTGACAGGCTATATGCGCGGCCAGCAGACCTGCAGGGCCCGCTCGTC"
[3] ">"
[4] "TACAGCCCCTCCAAAAAACAAAGACAGTTGGGAAGGTGTCAAATGGAGGAT"
[5] ">"
[6] "NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN"
[7] ">"
[8] "AGAGAAAGACTCCATCTCAAAAAAATAATAATAAAATAGATTTTGTAAGAA"
[9] ">"
[10] "TGGCCTCGGGTTAGTAAAGAAAGAAGGAAATGCAGCAGCCTATGACCAAGA"
[11] ">"
[12] "NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN"
[13] ">"
[14] "CTGGCCAGGCTGAGGCCCACAGTGAGTTCGTGATAAGGTAGGACCAGAGCC"
[15] ">"
[16] "GGATGGGACAAGAAGAAGCTGGGCTGACAAGCCCAACATAGTGGAGCCAGC"
[17] ">"
[18] "GACGGTGCTGAGTTCCCTGCACTCTCAGAAGGGACAGGCCCTATGCTGCCA"
[19] ">"
[20] "NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN"
You can add names for each FASTA entry
> names(seqs) <- paste0("Sequence_", 1:10)
> writeXStringSet(seqs, "whatevs.fa")
> readLines("whatevs.fa")
[1] ">Sequence_1"
[2] "GTGTGTGACAGGCTATATGCGCGGCCAGCAGACCTGCAGGGCCCGCTCGTC"
[3] ">Sequence_2"
[4] "TACAGCCCCTCCAAAAAACAAAGACAGTTGGGAAGGTGTCAAATGGAGGAT"
[5] ">Sequence_3"
[6] "NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN"
[7] ">Sequence_4"
[8] "AGAGAAAGACTCCATCTCAAAAAAATAATAATAAAATAGATTTTGTAAGAA"
[9] ">Sequence_5"
[10] "TGGCCTCGGGTTAGTAAAGAAAGAAGGAAATGCAGCAGCCTATGACCAAGA"
[11] ">Sequence_6"
[12] "NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN"
[13] ">Sequence_7"
[14] "CTGGCCAGGCTGAGGCCCACAGTGAGTTCGTGATAAGGTAGGACCAGAGCC"
[15] ">Sequence_8"
[16] "GGATGGGACAAGAAGAAGCTGGGCTGACAAGCCCAACATAGTGGAGCCAGC"
[17] ">Sequence_9"
[18] "GACGGTGCTGAGTTCCCTGCACTCTCAGAAGGGACAGGCCCTATGCTGCCA"
[19] ">Sequence_10"
[20] "NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN"
>
Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
version 2.3.6
Thank you very much. Your answer was really helpfull but i have a problem on using the GRanges and IRages seq from Bioconductor. The error that is appeared is: e(s) not installed when version(s) same as current; use force = TRUE to re-install: 'GenomeRanges'. Do you have any suggestion how to solve it. I tried different things such as dowload devtools and genefilter but nothing changed. Also, do you know some other sequence which can replace the GRanges and IRanges. Thank you.
It's better for us if you just copy and paste the R output rather than just a snippet like that. Do note that there isn't a package called
GenomeRangesso that might be your problem. You wantGenomicRangesinstead. The 'error' you post isn't an error, but instead a message telling you that you already have the current version of a package installed, and if you want to re-install you need to addforce = TRUEtoBiocManager::installin order to make it re-install. Otherwise it will just tell you that you already have the current version.If you do paste code, either enclose between a set of triple backticks (```) so it is formatted correctly, or alternatively paste the code, highlight the code, and then click on the button above the reply box that says 'code'.
My problem about the GRanges and IRanges was solved. But another problem was appeared. When i run this code:
gr <- GRanges(chr, IRanges(start = start,end = end)),it tells that:what did i do wrong? Thank you.