I have a DNAStringSet object of 23bp sequences (20bp Guide RNA sequence+ 3bp PAM ). I want to score them for a given reference genome. How can I use this DNAStringSet object in offTargetAnalysis() ?

Currently, In my offTargetAnalysis() I have used DNAStringSet object of 20bp gRNA sequences which doesn't include the PAM sequence and I have used the default value of PAM = NGG in offTargetAnalysis(). Now, In OffTargetAnalysis.xls if the value of my guide RNA in gRNAPlusPAM column is TGCTTGGGATGGTAATGTTGNGG, but my sequence of interest is TGCTTGGGATGGTAATGTTGTGG , how does this impact the scores (both efficiency and off target wise) ?

Thanks for the great question, Durbar!

In general, it will not impact the scores. The scores and efficacy will be calculated based on the sequences fetched from the genome unless you specify not to. However, if there are more than one genomic location sharing the same 20 bp sequence with different PAM sequences, then it is better to supply your 23bp gRNA sequences.

Best regards, Julie