Sir, It is not working according to your guidance.

My location of exdata  folder is "C:\Users\SUSHOVAN\Documents\R\win-library\3.4\CRISPRseek\extdata" , where I have put two  similar fasta sequences X1.fa and X2.fa  I have tried to run the following code and got that error. The file fize of X1.fa and X2.fa is 1 Kb and 1Kb. variation among the sequences is about 10%-20%.

I cut and paste  from X1 and X2.fa to  the predefined , preexisting files rs362331C.fa  and rs362331T.fa

but same problem.

What is the meaning of   'x' has "out of limits" views

search for gRNAs for input file1...
Validating input ...
Searching for gRNAs ...
<simpleError in fromXStringViewsToStringSet(x, out.of.limits = out.of.limits,     use.names = use.names): 'x' has "out of limits" views>
search for gRNAs for input file2...
Validating input ...
Searching for gRNAs ...
<simpleError in fromXStringViewsToStringSet(x, out.of.limits = out.of.limits,     use.names = use.names): 'x' has "out of limits" views>
[1] "Scoring ..."
Error in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern,  : 
  object 'gRNAs1' not found
In addition: Warning messages:
1: In dir.create(outputDir) :
  'C:\Users\SUSHOVAN\Documents\rs362331C.fa-Aug-19-2017' already exists
2: In dir.create(outputDir) :
  'C:\Users\SUSHOVAN\Documents\rs362331T.fa-Aug-19-2017' already exists
> inputFile1Path <- system.file("extdata", "rs362331C.fa", package = "CRISPRseek")
> inputFile1Path <- system.file("extdata", "rs362331C.fa", package = "CRISPRseek")
> inputFile2Path <- system.file("extdata", "rs362331T.fa", package = "CRISPRseek")
> seqs <- compare2Sequences(inputFile1Path, inputFile2Path,outputDir = outputDir , REpatternFile = REpatternFile,overwrite = TRUE)
search for gRNAs for input file1...
Validating input ...
Searching for gRNAs ...
<simpleError in fromXStringViewsToStringSet(x, out.of.limits = out.of.limits,     use.names = use.names): 'x' has "out of limits" views>
search for gRNAs for input file2...
Validating input ...
Searching for gRNAs ...
<simpleError in fromXStringViewsToStringSet(x, out.of.limits = out.of.limits,     use.names = use.names): 'x' has "out of limits" views>
[1] "Scoring ..."
Error in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern,  : 
  object 'gRNAs1' not found
In addition: Warning messages:
1: In dir.create(outputDir) :
  'C:\Users\SUSHOVAN\Documents\rs362331C.fa-Aug-19-2017' already exists
2: In dir.create(outputDir) :

**************** Should I give very small sequence for comparing two sequence  with only 1SNP.

***************** My input files were about 1Kb with 10-20 % variation (of nucleotide between those files).

Sir/Madam please help me 

Can you try these?

 readDNAStringSet(inputFile1Path)

 readDNAStringSet(inputFile2Path)

You should see your sequences. If not, then you need to make sure your files are in plain text format.

Alternatively, you can avoid storing input sequences in the file, and try to run the following code instead. Please replace the DNA sequences with your own two sequences.

inputFile1Path <- DNAStringSet("GACCCACGCCTGCTCCCTCATCTACTGTGTGCACTTCATCCTGGA")

names(inputFile1Path) <- "seq1"

inputFile2Path <- DNAStringSet("GACCCACGCCTGCTCCCTCATCCACTGTGTGCACTTCATCCTGGA")

names(inputFile2Path) <- "seq2"

seqs <- compare2Sequences(inputFile1Path, inputFile2Path,

    inputNames=c("Seq1", "Seq2"),

                scoring.method = "CFDscore",

        outputDir = getwd(), 
        overwrite = TRUE)

Best，

Julie

Madam I tried to follow your suggestion , but same problem

*************** Should I give  small sequence for comparing two sequence  with only 1SNP.

***************** My input files were about 1Kb with 10-20 % variation (of nucleotide between those files).

> inputFile1Path <- DNAStringSet("TAATATTTTAAAATCGGTGACGTGGGCCCAAAACGAGTGCAGTTCCAAAGGCACCCACCTGTGGCAGCGTCTCTCCTTTCACATCAAAAAGCGCGAAAGCAACCAGACGGCTGTGATCAAACCCTTCTCCAAGACATCTGAGGGACGCTACTGCGGAGGCAGCGACATAAACACGGACAACAGCAACAACAAGATGCTCTATGAAGTCACGGAGGCGGAGGAACGCTACCCAATCACCTACCGGCCCCAAACGCCCTCTCCAATCAGCACCGTCACACAAAGAGCTAGCATCGCTTTAGCACAAAGCTCTGACGCGCAGGTCATGAGTGTTTCTACGTACATGTGCCAGCCTCCACAGCATCGCGTGCCATGTCCTGGCGGAAGCGCGTCACAGGGCTCTCTAATGGAGCAGATTAGCTGTGTGGTAAACCGCTTCACTGCTAACATCAGCGAGCTTAATAGCATGATGCTCACCAGTTCTCCTCCAGGGGGAGCTGTCGGTTTATCCACTAGCACTTCAGCACACGTCCACTCACCTGAACCATGCTGTCCACCATCTTACCGCCTGTCCCGGGAGGTTTCCCTACCATCCACTATGACAACCTATGCTGAAATACAGCCACTCCCACCGGTGGAGTCAAACGTGGGTCGAGCTGCCACCTCCTGCCATCTTTCTGGACCATCACGACTGAAAACATCTCCAACAACCAGTGGGAATGAGCTAAAAGTGGGAGTGGCATCAGCTCTGGAGTCGCCGTCCAATCAACCGGAGCTTGAGGAACTGCTGGCGCTGACTCCGCCCTCCCCCTTTAGGGACTCGGTTGGGTCAGGCAGCGCTTCACCCAGTTCTCCAACATCCGATGCTGAAACTTCAGTACTTCCGACCATCCCTAAATACGAGTGCCTGGTGCTGCGACACTACAGCCAAAGCTCGTCTTCATTA")
> names(inputFile1Path) <- "seq1"
> inputFile2Path <- DNAStringSet("TAATATTTTAAAACCGGTGACGTGGGCCCAAAACGAGTGCAGTTCCAAAGGCACCCACCTGTGGCAGCGTATCTCCTTTCACATTAAAAAGCGCGAAAGCAACCTGACAGCTGTGAACGAACCCTACTCAAAGACATCTGTTGGACGATACTGCGGCGGCAGTGACATAAACACGGACAAGTGCAACACCAAGATGCTCTATGAAGTCACGGAGGCGGAGGAACGCTACCCAATTACCTACCTGCCCCAAACGCCCTCTCCAATCAGCACCGTCACACAAAGAGCGAGCATCGCTATAGCACAAAGCTCTGACGCGCAGGTCATGAGTGTTTCTACGTACATGTCCCAGCCTCCACAGCATCGCGTTCCATGTCCCGGCGGAAGAGCTTCACAGGGCTCTCTAATGGAGCAGATTAGCTTTGTGGTAAACCGCTACACTGCTAACATCATCGAGCTTCATAGAATGAGGCTCACCACTTCTGCTCCAGGGGGAGCTGTCAGATTATCCACTATCACTTCAGCACACGTCCAATCACCTGTACGATGCTCTCCGCCATCTTACCGCCCGTCCCGGGAGGTTTCCCTACCTTCCACTATGACAACCTATGTTGAAATTCAACCACTCCGACCGGTGGAGTCAAACGTAGGTGGAGCAGCCACCTCCTGCCATCTTTGTGGACCATCACGACTGAAAACATCTCCAACAACCAGTGGCAATGAGCTATATGTGGGACTGGCAGCAGCTCTGGACTTGTCGTCCAATTAACCGGAGCTTGAGGAACTGCTGGCGCTGCCTCCGCCCTCCCCCTTTAGGGACTCGGTTGGGTCAGGCAGCGCTTCACCCAGTTCTCCAACATCCGATGCTGAAACTTCAGTATTTCCGAGCATCCCTAAATACGAGTGCCTGGTGCTGCGACACTACAGCCAAAGCTCGTCTTCATTA"
+ )
> names(inputFile2Path) <- "seq2"
> seqs <- compare2Sequences(inputFile1Path, inputFile2Path,inputNames=c("Seq1", "Seq2"),scoring.method = "CFDscore",outputDir = getwd(), overwrite = TRUE)
search for gRNAs for input file1...
Validating input ...
Searching for gRNAs ...
<simpleError in fromXStringViewsToStringSet(x, out.of.limits = out.of.limits,     use.names = use.names): 'x' has "out of limits" views>
search for gRNAs for input file2...
Validating input ...
Searching for gRNAs ...
<simpleError in fromXStringViewsToStringSet(x, out.of.limits = out.of.limits,     use.names = use.names): 'x' has "out of limits" views>
[1] "Scoring ..."
Error in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern,  : 
  object 'gRNAs1' not found

Thanks Julie for your enormous effort.

I have 2/ 3 precise question 

Qs1 > Can I compare more than 2 that is 3  sequences by any other command.

Qs2.  What is the meaning of Target in  sequence 1 one and Target in  sequence 2.

if in same xls file , we are getting  common GRNAs , then why two separate file.

QS3.

 What is significance of field A  in xls  (file2_gr7)

Qs4.  Can we get common  GRNAs from the given 2 input sequences. 

Last and very imnportant for me

Q5: what will be the commands for only  potential off target analysis of a given  input sequence only.

Not species specific 

I do not want  chromosome and spices specific data.

gRNAFilePath <- system.file('extdata', 'testHsap_GATA1_ex2_gRNA1.fa',

+ package = 'CRISPRseek')

> results <- offTargetAnalysis(inputFilePath = gRNAFilePath,

+ findgRNAsWithREcutOnly = FALSE, REpatternFile = REpatternFile,

+ findPairedgRNAOnly = FALSE, findgRNAs = FALSE,

+ BSgenomeName = Hsapiens, chromToSearch = 'chrX',

+ txdb = TxDb.Hsapiens.UCSC.hg19.knownGene,

+ orgAnn = org.Hs.egSYMBOL,

+ max.mismatch = 1, outputDir = outputDir, overwrite = TRUE)

Susobhan,

Qs1 > Can I compare more than 2 that is 3  sequences by any other command.

Yes, you need to perform 3 separate analysis, i.e., seq1 vs seq2 and seq3, seq2 vs seq1 and seq3, seq3 vs seq1 and seq2.

Qs2.  What is the meaning of Target in  sequence 1 one and Target in  sequence 2.

if in same xls file , we are getting  common GRNAs , then why two separate file.

Please type ?compare2Sequences for more detailed description.  For your convenience, here is the section relevant to you.

Value

Return a data frame with all potential gRNAs from both sequences. In addition, a tab delimited file scoresFor2InputSequences.xls is also saved in the outputDir, sorted by scoreDiff descending.

QS3.

 What is significance of field A  in xls  (file2_gr7)

See above (the name field)

Qs4.  Can we get common  GRNAs from the given 2 input sequences. 

Yes, scoreDiff = 0 will be the common ones (you only need to look at one of the output files I sent to you via email)

Last and very imnportant for me

Q5: what will be the commands for only  potential off target analysis of a given  input sequence only.

Not species specific 

Can you please clarify? Do you mean you are not interested in the genome-wide off-target analysis? 

I do not want  chromosome and spices specific data.

Best regards,

Julie

Thanks Julie again,

Your previous reply was

Susobhan,

Bioconductor recently transitioned from SVN to github. I need to set up account to clone my package, do testing and make changes if needed. It will take me quite sometime maybe days if I do have a big chunk of time to do this.

Therefore, I decied to send you some results for you to look at in case you are in a hurry. Please let me know if this makes sense.Here are the code I used to generate the outputfile.

inputFile1Path <- DNAStringSet("TAATATTTTAAAATCGGTGACGTGGGCCCAAAACGAGTGCAGTTCCAAAGGCACCCACCTGTGGCAGCGTCTCTCCTTTCACATCAAAAAGCGCGAAAGCAACCAGACGGCTGTGATCAAACCCTTCTCCAAGACATCTGAGGGACGCTACTGCGGAGGCAGCGATGCTGCGACACTACAGCCAAAGCTCGTCTTCATTA")

names(inputFile1Path) <- "file1"

inputFile2Path <- DNAStringSet("TAATATTTTAAAACCGGTGACGTGGGCCCAAAACGAGTGCAGTTCCAAAGGCACCCACCTGTGGCAGCGTATCTCCTTTCACATTAAAAAGCGCGAAAGCAACCTGACAGCTGTGAACGAACCCTACTCAAAGACATCTGTTGGACGATACTGCGGCGGCAGTGACATAAACACGGACAAGTGCAACACCAAGATGCTCTATGAAGTCACGGAGGCGGAGGAACGCTACCCAATTACCTACCTGCCCCAAACGCGACACTACAGCCAAAGCTCGTCTTCATTA")

names(inputFile2Path) <- "file2"

gRNAs1 <- findgRNAs(inputFile1Path, pairOutputFile ="testPair.xls", calculategRNAEfficacy = FALSE)

if (!file.exists("gRNAs4seq1"))

    dir.create(file.path(getwd(), "gRNAs4seq1"))

 compare2Sequences(gRNAs1, inputFile2Path, inputNames=c("Seq1", "Seq2"),findgRNAs = c(FALSE, TRUE), searchDir = "1to2",

scoring.method = "CFDscore",outputDir = "gRNAs4seq1", overwrite = TRUE)

gRNAs2 <- findgRNAs(inputFile2Path, pairOutputFile ="testPair.xls", calculategRNAEfficacy = FALSE)

if (!file.exists("gRNAs4seq2"))

    dir.create(file.path(getwd(), "gRNAs4seq2"))

 compare2Sequences(gRNAs2, inputFile1Path, inputNames=c("Seq2", "Seq1"),findgRNAs = c(FALSE, TRUE), searchDir = "1to2",

scoring.method = "CFDscore",outputDir = "gRNAs4seq2",  overwrite = TRUE)

Best,

Julie

Susobhan,

Bioconductor recently transitioned from SVN to github. I need to set up account to clone my package, do testing and make changes if needed. It will take me quite sometime maybe days if I do have a big chunk of time to do this.

Therefore, I decied to send you some results for you to look at in case you are in a hurry. Please let me know if this makes sense.

Here are the code I used to generate the outputfile.

**************************************************************************************************************************************

1. Yes then it is ok 

I need to run the above code to  compare  two large sequence.

But I am following the above code but it is not running.

Giving same error that I have mentioned . The out put u sent it will help me lots.

You told you need to change few package. 

Please  confirm me then if it is modified.

2. I want to get all potential off-target GRNAs from a single sequence.

Where, I do not want to mention any chromosome, species  etc.

Just input information will be Long Input genome sequence.

What will be the command in that case  

3. Julie, can you help me to clear the concept of Off target?

What i understood  from papers, materials that it is similar kind of pattern over the sequence, which is very complex to handle  genome edit. because it can be wrongly cleaved to another side.

Susobhan,

Please try the following code, it should work and produce a file called scoresFor2InputSequences.xls in your output directory.

Please note that I removed one base at the beginning of your sequences. I need to fix the code in the github. However, I need wait for a day to be able to download CRISPRseek with read and write access. Will let you know once the package is updated. Meanwhile, the following approach should work (remove one base from the beginning of your sequences).

inputFile1Path <- DNAStringSet("AATATTTTAAAATCGGTGACGTGGGCCCAAAACGAGTGCAGTTCCAAAGGCACCCACCTGTGGCAGCGTCTCTCCTTTCACATCAAAAAGCGCGAAAGCAACCAGACGGCTGTGATCAAACCCTTCTCCAAGACATCTGAGGGACGCTACTGCGGAGGCAGCGACATAAACACGGACAACAGCAACAACAAGATGCTCTATGAAGTCACGGAGGCGGAGGAACGCTACCCAATCACCTACCGGCCCCAAACGCCCTCTCCAATCAGCACCGTCACACAAAGAGCTAGCATCGCTTTAGCACAAAGCTCTGACGCGCAGGTCATGAGTGTTTCTACGTACATGTGCCAGCCTCCACAGCATCGCGTGCCATGTCCTGGCGGAAGCGCGTCACAGGGCTCTCTAATGGAGCAGATTAGCTGTGTGGTAAACCGCTTCACTGCTAACATCAGCGAGCTTAATAGCATGATGCTCACCAGTTCTCCTCCAGGGGGAGCTGTCGGTTTATCCACTAGCACTTCAGCACACGTCCACTCACCTGAACCATGCTGTCCACCATCTTACCGCCTGTCCCGGGAGGTTTCCCTACCATCCACTATGACAACCTATGCTGAAATACAGCCACTCCCACCGGTGGAGTCAAACGTGGGTCGAGCTGCCACCTCCTGCCATCTTTCTGGACCATCACGACTGAAAACATCTCCAACAACCAGTGGGAATGAGCTAAAAGTGGGAGTGGCATCAGCTCTGGAGTCGCCGTCCAATCAACCGGAGCTTGAGGAACTGCTGGCGCTGACTCCGCCCTCCCCCTTTAGGGACTCGGTTGGGTCAGGCAGCGCTTCACCCAGTTCTCCAACATCCGATGCTGAAACTTCAGTACTTCCGACCATCCCTAAATACGAGTGCCTGGTGCTGCGACACTACAGCCAAAGCTCGTCTTCATTA")

names(inputFile1Path) <- "file1"

inputFile2Path <- DNAStringSet("AATATTTTAAAACCGGTGACGTGGGCCCAAAACGAGTGCAGTTCCAAAGGCACCCACCTGTGGCAGCGTATCTCCTTTCACATTAAAAAGCGCGAAAGCAACCTGACAGCTGTGAACGAACCCTACTCAAAGACATCTGTTGGACGATACTGCGGCGGCAGTGACATAAACACGGACAAGTGCAACACCAAGATGCTCTATGAAGTCACGGAGGCGGAGGAACGCTACCCAATTACCTACCTGCCCCAAACGCCCTCTCCAATCAGCACCGTCACACAAAGAGCGAGCATCGCTATAGCACAAAGCTCTGACGCGCAGGTCATGAGTGTTTCTACGTACATGTCCCAGCCTCCACAGCATCGCGTTCCATGTCCCGGCGGAAGAGCTTCACAGGGCTCTCTAATGGAGCAGATTAGCTTTGTGGTAAACCGCTACACTGCTAACATCATCGAGCTTCATAGAATGAGGCTCACCACTTCTGCTCCAGGGGGAGCTGTCAGATTATCCACTATCACTTCAGCACACGTCCAATCACCTGTACGATGCTCTCCGCCATCTTACCGCCCGTCCCGGGAGGTTTCCCTACCTTCCACTATGACAACCTATGTTGAAATTCAACCACTCCGACCGGTGGAGTCAAACGTAGGTGGAGCAGCCACCTCCTGCCATCTTTGTGGACCATCACGACTGAAAACATCTCCAACAACCAGTGGCAATGAGCTATATGTGGGACTGGCAGCAGCTCTGGACTTGTCGTCCAATTAACCGGAGCTTGAGGAACTGCTGGCGCTGCCTCCGCCCTCCCCCTTTAGGGACTCGGTTGGGTCAGGCAGCGCTTCACCCAGTTCTCCAACATCCGATGCTGAAACTTCAGTATTTCCGAGCATCCCTAAATACGAGTGCCTGGTGCTGCGACACTACAGCCAAAGCTCGTCTTCATTA")

names(inputFile2Path) <- "file2"

seqs <- compare2Sequences(inputFile1Path, inputFile2Path, inputNames=c("Seq1", "Seq2"),scoring.method = "CFDscore",outputDir = getwd(), overwrite = TRUE)

I do not see use cases for #2. 

Offtargets here means sites, not intended for cut, might get cut.

Best regards,

Julie

Your reply was

Q5: what will be the commands for only  potential off target analysis of a given  input sequence only.

Not species specific 

Can you please clarify? Do you mean you are not interested in the genome-wide off-target analysis? 

Yes 

I want to get all potential off-target GRNAs from a single sequence.

Where,  Just input information will be Long Input genome sequence.

What will be the command in that case .

regards

Baidya 

Baidya,

Please try the function compare2Sequences with

inputFile1Path and inputFile2Path containing the same sequence,  and set 

searchDirection = "1to2".

Best,

Julie

I cant get your answer, if you do not mind, can you please write complete code for that  example, 

I am very new with R.

Keenly waiting for your reply

inputFile1Path <- DNAStringSet("AATATTTTAAAATCGGTGACGTGGGCCCAAAACGAGTGCAGTTCCAAAGGCACCCACCTGTGGCAGCGTCTCTCCTTTCACATCAAAAAGCGCGAAAGCAACCAGACGGCTGTGATCAAACCCTTCTCCAAGACATCTGAGGGACGCTACTGCGGAGGCAGCGACATAAACACGGACAACAGCAACAACAAGATGCTCTATGAAGTCACGGAGGCGGAGGAACGCTACCCAATCACCTACCGGCCCCAAACGCCCTCTCCAATCAGCACCGTCACACAAAGAGCTAGCATCGCTTTAGCACAAAGCTCTGACGCGCAGGTCATGAGTGTTTCTACGTACATGTGCCAGCCTCCACAGCATCGCGTGCCATGTCCTGGCGGAAGCGCGTCACAGGGCTCTCTAATGGAGCAGATTAGCTGTGTGGTAAACCGCTTCACTGCTAACATCAGCGAGCTTAATAGCATGATGCTCACCAGTTCTCCTCCAGGGGGAGCTGTCGGTTTATCCACTAGCACTTCAGCACACGTCCACTCACCTGAACCATGCTGTCCACCATCTTACCGCCTGTCCCGGGAGGTTTCCCTACCATCCACTATGACAACCTATGCTGAAATACAGCCACTCCCACCGGTGGAGTCAAACGTGGGTCGAGCTGCCACCTCCTGCCATCTTTCTGGACCATCACGACTGAAAACATCTCCAACAACCAGTGGGAATGAGCTAAAAGTGGGAGTGGCATCAGCTCTGGAGTCGCCGTCCAATCAACCGGAGCTTGAGGAACTGCTGGCGCTGACTCCGCCCTCCCCCTTTAGGGACTCGGTTGGGTCAGGCAGCGCTTCACCCAGTTCTCCAACATCCGATGCTGAAACTTCAGTACTTCCGACCATCCCTAAATACGAGTGCCTGGTGCTGCGACACTACAGCCAAAGCTCGTCTTCATTA")

inputFile2Path <- inputFile1Path

names(inputFile1Path) <- "file1"

names(inputFile2Path) <- "file2"

seqs <- compare2Sequences(inputFile1Path, inputFile2Path, inputNames=c("Seq1", "Seq2"),scoring.method = "CFDscore",

searchDirection = "1to2", outputDir = getwd(), overwrite = TRUE)

I think you will benefit greatly from learning some basics about R.

Best,

Julie

Thank you julie,

Can you tell me, in the column of F in xls sheet sgrna efficiency means what?

What is the scoring mechanism ( Doench Activity score or Efficiency score )

Yes I got your attached file.

Thank you Julie.

I understood Score difference Zero means Common GRNA.

Q1. But Score Difference One means what ?

Q2. Still I want to know the formula of sgRNA efficiency score which is fractional. 

How it is coming.

Q3. High Score means what ? is it stable sgRNA chunk to be edited by CRISPR CAS9?

Is it calculated by  DOENCH ACTIVITY SCORE.

I read your Workshop pdf.

There it is not  mentioned