Hello,

I recently downloaded CRISPRSeek and I got the tests to work in the vignette (specifically Scenario 5: Target and off-target analysis for user specified gRNAs) and the output looks wonderful. When I tried to replicate the results with a test file on my own, however, I got the error as described in the post title. Here is the following code that I ran:

library(CRISPRseek)
library(BSgenome.Hsapiens.UCSC.hg19)
library(TxDb.Hsapiens.UCSC.hg19.knownGene)
library(org.Hs.eg.db)

input_path = 'Path_to_pwd/Input.fasta'
output_dir = 'Path_to_pwd/CRISPRSeek_Output'
REpatternFile = system.file('extdata','NEBenzymes.fa', package ='CRISPRseek')

offTargetAnalysis(inputFilePath = input_path,
                  findgRNAsWithREcutOnly = FALSE,
                  REpattenFile = REpattenFile,
                  findPairedgRNAOnly = FALSE,
                  findgRNAs = FALSE,
                  BSgenomeName = Hsapiens,
                  txd = TxDb.Hsapiens.UCSC.hg19.knownGene,
                  orgAnn = org.Hs.egSYMBOL,
                  max.mismatch = 0,
                  outputDir = output_dir,
                  overwrite = TRUE)

Validating input ...
>>> Finding all hits in sequence chr1 ...
>>> DONE searching
>>> Finding all hits in sequence chr2 ...
>>> DONE searching
>>> Finding all hits in sequence chr3 ...
>>> DONE searching
.
.
.
>>> DONE searching
>>> Finding all hits in sequence chrUn_gl000249 ...
>>> DONE searching
Building feature vectors for scoring ...
Calculating scores ...
Error in weights %*% mismatch.pos : non-conformable arguments
In addition: Warning message:
In dir.create(outputDir) :
  'path_to_pwd\CRISPRSeek_Output' already exists

Here is the output of the traceback() function:

> traceback()
2: getOfftargetScore(featureVectors, weights = weights)
1: offTargetAnalysis(inputFilePath = input_path, findgRNAsWithREcutOnly = FALSE, 
       REpatternFile = REpatternFile, findPairedgRNAOnly = FALSE, 
       findgRNAs = FALSE, BSgenomeName = Hsapiens, txd = TxDb.Hsapiens.UCSC.hg19.knownGene, 
       orgAnn = org.Hs.egSYMBOL, max.mismatch = 0, outputDir = output_dir, 
       overwrite = TRUE)

Here is a sample of input.fasta (Total number of gRNAs is 613 sequences):

>Ref.A1.RW.92.92RW008.AB253421_0
TGGAAGGGCTAATTTACTCC
>Ref.A1.RW.92.92RW008.AB253421_1
GGAAGGGCTAATTTACTCCA
>Ref.A1.RW.92.92RW008.AB253421_2
GAAGGGCTAATTTACTCCAA
>Ref.A1.RW.92.92RW008.AB253421_3
AAGGGCTAATTTACTCCAAG

Here is the output of the sessionInfo() command:

> sessionInfo(package = "CRISPRseek")
R version 3.3.1 (2016-06-21)
Platform: x86_64-w64-mingw32/x64 (64-bit)
Running under: Windows >= 8 x64 (build 9200)

locale:
[1] LC_COLLATE=English_United States.1252  LC_CTYPE=English_United States.1252   
[3] LC_MONETARY=English_United States.1252 LC_NUMERIC=C                          
[5] LC_TIME=English_United States.1252    

attached base packages:
character(0)

other attached packages:
[1] CRISPRseek_1.12.0

loaded via a namespace (and not attached):
 [1] Rcpp_0.12.12                            GenomeInfoDb_1.8.7                     
 [3] XVector_0.12.1                          methods_3.3.1                          
 [5] GenomicFeatures_1.24.5                  bitops_1.0-6                           
 [7] utils_3.3.1                             tools_3.3.1                            
 [9] grDevices_3.3.1                         zlibbioc_1.18.0                        
[11] biomaRt_2.28.0                          digest_0.6.12                          
[13] bit_1.1-12                              RSQLite_2.0                            
[15] memoise_1.1.0                           tibble_1.3.3                           
[17] BSgenome_1.40.1                         TxDb.Hsapiens.UCSC.hg19.knownGene_3.2.2
[19] pkgconfig_2.0.1                         rlang_0.1.1                            
[21] DBI_0.7                                 parallel_3.3.1                         
[23] rtracklayer_1.32.2                      Biostrings_2.40.2                      
[25] S4Vectors_0.10.3                        graphics_3.3.1                         
[27] datasets_3.3.1                          stats_3.3.1                            
[29] IRanges_2.6.1                           stats4_3.3.1                           
[31] ade4_1.7-6                              bit64_0.9-7                            
[33] base_3.3.1                              data.table_1.10.4                      
[35] Biobase_2.32.0                          hash_2.2.6                             
[37] BSgenome.Hsapiens.UCSC.hg19_1.4.0       AnnotationDbi_1.34.4                   
[39] XML_3.98-1.9                            BiocParallel_1.6.6                     
[41] seqinr_3.4-5                            blob_1.1.0                             
[43] org.Hs.eg.db_3.3.0                      Rsamtools_1.24.0                       
[45] GenomicAlignments_1.8.4                 BiocGenerics_0.18.0                    
[47] GenomicRanges_1.24.3                    SummarizedExperiment_1.2.3             
[49] RCurl_1.95-4.8                        

I tried searching around on BioStars, Bioconductor forums, and Stack, but I could not find an answer.

Thank you very much!

Hi Robert,

I noticed that your installed version is CRISPRseek_1.12.0. Could you please install the most recent version and let me know if it works as expected? Thanks!

FYI, the old version requires that the gRNA input file contains a list of gRNAs with PAM sequence, i.e., 23 instead of 20 nt for SpCas9.

I tried the sequences you listed and it works although it seems that there is no perfect match found in the human genome. I am wondering whether the gRNAs you provided are human sequences.

Best regards,

Julie