Hi everybody, I have a question about using the matchDNAPattern in the Biostrings package. I have a DNA string,eg a=DNAString("AGCTGACTCAGTGGCTTGCT"),and i want to find a pattern,eg p="AGCT" with one mismatch.So i use : > matchDNAPattern("AGCT",a,mismatch=1) Object of class BioString with Pattern alphabet: -TGCANBDHKMRSVWY Values: [1] AGC [2] AGCT [3] GCTG [4] GACT [5] CAGT [6] GGCT [7] TGCT But i just want those subsequence who's base order is coherent to the search pattern.eg,AGCT is a perfect match;GGCT,CGCT,TGCT with one mismatch;and AGC,GCTG,CAGT are also in the result list,but the position of base are changed compared to the search pattern,i don't want them. How can i achieve this goal? [[alternative HTML version deleted]]

Hi Xiao, Right now the code seems not to do quite what you want, it allows for insertions, substitutions and deletions, where if I understand you are only interested in substitutions. I will see about modifying it so that you can specify each of these parameters directly - that is the number of insertions, deletions and substitutions, rather than the current "global" setting. But that will take a few days, and will surely miss the release. Best wishes Robert On May 13, 2005, at 9:47 PM, Xiao Shi wrote: > Hi everybody, > I have a question about using the matchDNAPattern in the Biostrings > package. > I have a DNA string,eg a=DNAString("AGCTGACTCAGTGGCTTGCT"),and i want > to > find a pattern,eg p="AGCT" with one mismatch.So i use : >> matchDNAPattern("AGCT",a,mismatch=1) > Object of class BioString with > Pattern alphabet: -TGCANBDHKMRSVWY > Values: > [1] AGC > [2] AGCT > [3] GCTG > [4] GACT > [5] CAGT > [6] GGCT > [7] TGCT > But i just want those subsequence who's base order is coherent to the > search > pattern.eg,AGCT is a perfect match;GGCT,CGCT,TGCT with one mismatch;and > AGC,GCTG,CAGT are also in the result list,but the position of base are > changed compared to the search pattern,i don't want them. > How can i achieve this goal? > > [[alternative HTML version deleted]] > > _______________________________________________ > Bioconductor mailing list > Bioconductor@stat.math.ethz.ch > https://stat.ethz.ch/mailman/listinfo/bioconductor > > +--------------------------------------------------------------------- -- ----------------+ | Robert Gentleman phone: (206) 667-7700 | | Head, Program in Computational Biology fax: (206) 667-1319 | | Division of Public Health Sciences office: M2-B865 | | Fred Hutchinson Cancer Research Center | | email: rgentlem@fhcrc.org | +--------------------------------------------------------------------- -- ----------------+