Hi there

I am looking for paired sgRNA off target sites in the human genome (I already have my on target pair). I am using SaCas9 with two 21 nt sgRNAs. I have no coding background and this is a pretty simple problem! 

I am unable to get the inputFilePath to save and be recognized in R. I have a Dell laptop with Windows and I am using R-3.3.1. I tried to use WordPad to save my target sequence which contains my pre-selected sgRNA pair as a fasta file. What I did was type this into the WordPad doc:

>

ATTCCCAGCGCACTGCTGCATGTTTTGGCCTGAATAATCAGACTCTTGGGATGAAGGTCAAGCTGCATGGACCTTCCAGGAAGCTCTAATATGCAGGTGA

and then I clicked save as -> Seq1.fasta in the working directory as a text file (not rich text). Then when I run the code:

> library(CRISPRseek)

> library(BSgenome.Hsapiens.UCSC.hg19)

> library(TxDb.Hsapiens.UCSC.hg19.knownGene) 

> inputFilePath <- "Seq1.fa" #I also tried "Seq1.fasta" but that also did not work

> results <- offTargetAnalysis(inputFilePath, format="fasta", findgRNAs=TRUE, exportAllgRNAs=c("all", "fasta", "genbank", "no"), findgRNAsWithREcutOnly=FALSE, findPairedgRNAOnly=TRUE, min.gap=0, max.gap=20, gRNA.name.prefix="gRNA", PAM.size=6, gRNA.size=21, PAM="NNG[A|G][A|G]T", BSgenomeName=Hsapiens, chromToSearch="all", max.mismatch=4, PAM.pattern = "NNG[A|G][A|G]N$", gRNA.pattern="^G", min.score=0, topN=1000, topN.OfftargetTotalScore=10, annotateExon=TRUE, txdb=TxDb.Hsapiens.UCSC.hg19.knownGene, outputDir=outputDir, fetchSequence=TRUE, upstream=200, downstream=200, weights=c(0, 0, 0, 0.014, 0, 0, 0.395, 0.317, 0, 0.389, 0.079, 0.445, 0.508, 0.613, 0.851, 0.732, 0.828, 0.615, 0.804, 0.685, 0.583), overwrite=FALSE)

I get the following message and error messages:

Validating input ...

Searching for gRNAs ...

Error in findgRNAs(inputFilePath, findPairedgRNAOnly = findPairedgRNAOnly,  : 

  The input file contains no sequence! This could be caused by 

            wrong format of the file. If file is created in mac, you could 

            reformat to text by typing tr "\r" "\n" >newfile in the 

            command line

In addition: Warning message:

In dir.create(outputDir) : 'C:\Users\Britt Hanson\Documents' already exists

> 

Does anyone have any advice to help with saving the fasta sequence file so that it is recognized as the inputFilePath in the code? 

Thanks, Britt

Johannesburg, South Africa

Britt, how about trying to add a name for the sequence in the file and use textEdit to save it as a plain text file?

>seq1

ATTCCCAGCGCACTGCTGCATGTTTTGGCCTGAATAATCAGACTCTTGGGATGAAGGTCAAGCTGCATGGACCTTCCAGGAAGCTCTAATATGCAGGTGA

Alternatively, you can set inputFilePath as a DNAStringSet.

inputFilePath <-DNAStringSet("ATTCCCAGCGCACTGCTGCATGTTTTGGCCTGAATAATCAGACTCTTGGGATGAAGGTCAAGCTGCATGGACCTTCCAGGAAGCTCTAATATGCAGGTGA")

names(inputFilePath) <- "seq1"

Best,

Julie