Hi, list: I encountered the following problem when I was running gcrma: > gcrma.m600<-gcrma(Scoe.m600.exp) Computing affinities.Error in compute.affinities(cdfName(object), verbose = verbose) : NAs are not allowed in subscripted assignments How can I find out where the problem occurred? Thanks, wenqiong ---------------------------------------------------------------------- -------- This email message and any attachments are confidential and ...{{dropped}}

You can see the content of function compute.affinities by >compute.affinities #let cdfname be your chip type and cdfname=cdfName(Scoe.m600.exp) verbose=TRUE ## then you can run the content of the function and see where the error happens On Mon, 28 Mar 2005, Wenqiong Chen wrote: > Hi, list: > I encountered the following problem when I was running gcrma: > > > gcrma.m600<-gcrma(Scoe.m600.exp) > Computing affinities.Error in compute.affinities(cdfName(object), > verbose = verbose) : > NAs are not allowed in subscripted assignments > > How can I find out where the problem occurred? > Thanks, > wenqiong > > > -------------------------------------------------------------------- ---------- > This email message and any attachments are confidential and ...{{dropped}} > > _______________________________________________ > Bioconductor mailing list > Bioconductor@stat.math.ethz.ch > https://stat.ethz.ch/mailman/listinfo/bioconductor >

Wenqiong Chen wrote: > Hi, list: > I encountered the following problem when I was running gcrma: > > >>gcrma.m600<-gcrma(Scoe.m600.exp) > > Computing affinities.Error in compute.affinities(cdfName(object), > verbose = verbose) : > NAs are not allowed in subscripted assignments > > How can I find out where the problem occurred? First, you could tell us what versions of R, gcrma, etc you are using, as well as what type of chip. If it is a non-standard chip, where did you get the cdfenv? Second, if you are trying to debug yourself, you can start with a traceback() after you get the error, which should help pinpoint where things went wrong. You can then step through the offending function using debug(). HTH, Jim > Thanks, > wenqiong > > > -------------------------------------------------------------------- ---------- > This email message and any attachments are confidential and ...{{dropped}} > > _______________________________________________ > Bioconductor mailing list > Bioconductor@stat.math.ethz.ch > https://stat.ethz.ch/mailman/listinfo/bioconductor -- James W. MacDonald Affymetrix and cDNA Microarray Core University of Michigan Cancer Center 1500 E. Medical Center Drive 7410 CCGC Ann Arbor MI 48109 734-647-5623

O.K, here is the step where the error started to occur when I run the content of the function "compute.affinities".. " > getProbePackage(probepackagename) [1] "Checking to see if your internet connection works..." Error in install.packages2(probepackage, lib = lib) : recursive default argument reference " Alternatively, when I use: > getProbePackage(disdiv712aprobe) #disdiv712aprobe is the probepackagename Warning messages: 1: the condition has length > 1 and only the first element will be used in: if (package %in% c("ctest", "eda", "modreg", "mva", "nls", "stepfun", 2: the condition has length > 1 and only the first element will be used in: if (package == "mle") { 3: the condition has length > 1 and only the first element will be used in: if (package == "lqs") { [1] "Checking to see if your internet connection works..." Note: You did not specify a download type. Using a default value of: Win32 This will be fine for almost all users Error in FUN(X[[2]], ...) : Malformed 'pkgs' parameter " I also noticed that when I execute this line, it attempts to download something from BioConductor. As Jim already realized, this is not a public GeneChip, but did adopt a standard Affy design. I made the cdf and probe packages by myself using the functions in BioConductor. The R version I am using is R2.0.1, the gcrma package is from the BioConductor 1.5 release. Thanks! wenqiong . -----Original Message----- From: Zhijin Wu [mailto:zwu@jhsph.edu] Sent: Tuesday, March 29, 2005 6:20 AM To: Wenqiong Chen Cc: Bioconductor@stat.math.ethz.ch Subject: Re: [BioC] gcrma problem You can see the content of function compute.affinities by >compute.affinities #let cdfname be your chip type and cdfname=cdfName(Scoe.m600.exp) verbose=TRUE ## then you can run the content of the function and see where the error happens On Mon, 28 Mar 2005, Wenqiong Chen wrote: > Hi, list: > I encountered the following problem when I was running gcrma: > > > gcrma.m600<-gcrma(Scoe.m600.exp) > Computing affinities.Error in compute.affinities(cdfName(object), > verbose = verbose) : > NAs are not allowed in subscripted assignments > > How can I find out where the problem occurred? > Thanks, > wenqiong > > > ---------------------------------------------------------------------- > -------- This email message and any attachments are confidential and > ...{{dropped}} > > _______________________________________________ > Bioconductor mailing list > Bioconductor@stat.math.ethz.ch > https://stat.ethz.ch/mailman/listinfo/bioconductor > ---------------------------------------------------------------------- -------- This email message and any attachments are confidential and ...{{dropped}}

This is something which frustrates me again! Yes, I did do "R CMD INSTALL" from the dos command line, and I can clearly see that the package is in the R library. Regarding the naming issue, I did not specify anything. Right now, the two packages I built in the library is "disdiv712acdf", and "disdiv712aprobe". Looks pretty consistent. There is clearly something not trivial there which caused the problem, maybe related to my computer? I am going to give a try in the unix system and see what happens. Thanks a lot for your help! Wenqiong -----Original Message----- From: James W. MacDonald [mailto:jmacdon@med.umich.edu] Sent: Tuesday, March 29, 2005 11:38 AM To: Wenqiong Chen Cc: Bioconductor@stat.math.ethz.ch Subject: Re: [BioC] gcrma problem Wenqiong Chen wrote: > > O.K, here is the step where the error started to occur when I run the > content of the function "compute.affinities".. " > >> getProbePackage(probepackagename) > > [1] "Checking to see if your internet connection works..." Error in > install.packages2(probepackage, lib = lib) : recursive default > argument reference " Alternatively, when I use: > >> getProbePackage(disdiv712aprobe) #disdiv712aprobe is the >> probepackagename > > Warning messages: 1: the condition has length > 1 and only the first > element will be used in: if (package %in% c("ctest", "eda", "modreg", > "mva", "nls", "stepfun", 2: the condition has length > 1 and only the > first element will be used in: if (package == "mle") { 3: the > condition has length > 1 and only the first element will be used in: > if (package == "lqs") { [1] "Checking to see if your internet > connection works..." Note: You did not specify a download type. > Using a default value of: Win32 This will be fine for almost all users > > Error in FUN(X[[2]], ...) : Malformed 'pkgs' parameter " I also > noticed that when I execute this line, it attempts to download > something from BioConductor. > > As Jim already realized, this is not a public GeneChip, but did adopt > a standard Affy design. I made the cdf and probe packages by myself > using the functions in BioConductor. The R version I am using is > R2.0.1, the gcrma package is from the BioConductor 1.5 release. The function getProbePackage() is trying to download the probe package from the BioC website because it thinks the correct one is not installed. When you made the cdf and probe packages yourself, did you specify a name for either? If so, this may be the cause of the problem. In addition, after making the packages, did you install them using R CMD INSTALL? If you didn't install them, then they will not be available for R to use, which is another possibility. If you are on a *nix machine, installing should be straightforward. If you are on MacOS or Windows, you may need to get some tools. If so, you will need to see the corresponding FAQ on the R-project website. HTH, Jim -- James W. MacDonald Affymetrix and cDNA Microarray Core University of Michigan Cancer Center 1500 E. Medical Center Drive 7410 CCGC Ann Arbor MI 48109 734-647-5623 ---------------------------------------------------------------------- -------- This email message and any attachments are confidential and ...{{dropped}}

Hi, Jim: Thanks for debugging for me! I tried the following commands and got exactly what you have expected. Also, I tried everything in the unix system, and got exactly the same error message. Wenqiong -----Original Message----- From: James W. MacDonald [mailto:jmacdon@med.umich.edu] Sent: Tuesday, March 29, 2005 12:14 PM To: Wenqiong Chen Cc: Bioconductor@stat.math.ethz.ch Subject: Re: [BioC] gcrma problem What happens if you do: library(disdiv712aprobe) data.frame(disdiv712aprobe)[1:10,] You should get something like: sequence x y Probe.Set.Name Probe.Interrogation.Position Target.Strandedness 1 CACCCAGCTGGTCCTGTGGATGGGA 718 317 1007_s_at 3330 Antisense 2 GCCCCACTGGACAACACTGATTCCT 1105 483 1007_s_at 3443 Antisense 3 TGGACCCCACTGGCTGAGAATCTGG 584 901 1007_s_at 3512 Antisense 4 AAATGTTTCCTTGTGCCTGCTCCTG 192 205 1007_s_at 3563 Antisense 5 TCCTTGTGCCTGCTCCTGTACTTGT 844 979 1007_s_at 3570 Antisense 6 TGCCTGCTCCTGTACTTGTCCTCAG 537 971 1007_s_at 3576 Antisense 7 TCCTGTACTTGTCCTCAGCTTGGGC 748 983 1007_s_at 3583 Antisense 8 ACTTGTCCTCAGCTTGGGCTTCTTC 1119 177 1007_s_at 3589 Antisense 9 TCCTCCATCACCTGAAACACTGGAC 504 983 1007_s_at 3615 Antisense 10 AAGCCTATACGTTTCTGTGGAGTAA 624 245 1007_s_at 3713 Antisense > How about library(disdiv712acdf) get(ls(disdiv712acdf), disdiv712acdf) You should get something like: pm mm [1,] 369707 370871 [2,] 563318 564482 [3,] 1049349 1050513 [4,] 238813 239977 [5,] 1140401 1141565 [6,] 1130782 1131946 [7,] 1144961 1146125 [8,] 207148 208312 [9,] 1144717 1145881 [10,] 285805 286969 [11,] 1351879 1353043 [12,] 1170814 1171978 [13,] 906807 907971 [14,] 547053 548217 [15,] 1221909 1223073 [16,] 27611 28775 Wenqiong Chen wrote: > This is something which frustrates me again! > Yes, I did do "R CMD INSTALL" from the dos command line, and I can clearly see that the package is in the R library. > Regarding the naming issue, I did not specify anything. Right now, the two packages I built in the library is "disdiv712acdf", and "disdiv712aprobe". Looks pretty consistent. > There is clearly something not trivial there which caused the problem, maybe related to my computer? I am going to give a try in the unix system and see what happens. > Thanks a lot for your help! > Wenqiong > > > -----Original Message----- > From: James W. MacDonald [mailto:jmacdon@med.umich.edu] > Sent: Tuesday, March 29, 2005 11:38 AM > To: Wenqiong Chen > Cc: Bioconductor@stat.math.ethz.ch > Subject: Re: [BioC] gcrma problem > > Wenqiong Chen wrote: > >>O.K, here is the step where the error started to occur when I run the >>content of the function "compute.affinities".. " >> >> >>>getProbePackage(probepackagename) >> >>[1] "Checking to see if your internet connection works..." Error in >>install.packages2(probepackage, lib = lib) : recursive default >>argument reference " Alternatively, when I use: >> >> >>>getProbePackage(disdiv712aprobe) #disdiv712aprobe is the >>>probepackagename >> >>Warning messages: 1: the condition has length > 1 and only the first >>element will be used in: if (package %in% c("ctest", "eda", "modreg", >>"mva", "nls", "stepfun", 2: the condition has length > 1 and only the >>first element will be used in: if (package == "mle") { 3: the >>condition has length > 1 and only the first element will be used in: >>if (package == "lqs") { [1] "Checking to see if your internet >>connection works..." Note: You did not specify a download type. >>Using a default value of: Win32 This will be fine for almost all users >> >>Error in FUN(X[[2]], ...) : Malformed 'pkgs' parameter " I also >>noticed that when I execute this line, it attempts to download >>something from BioConductor. >> >>As Jim already realized, this is not a public GeneChip, but did adopt >>a standard Affy design. I made the cdf and probe packages by myself >>using the functions in BioConductor. The R version I am using is >>R2.0.1, the gcrma package is from the BioConductor 1.5 release. > > > The function getProbePackage() is trying to download the probe package from the BioC website because it thinks the correct one is not installed. When you made the cdf and probe packages yourself, did you specify a name for either? If so, this may be the cause of the problem. > > In addition, after making the packages, did you install them using R CMD INSTALL? If you didn't install them, then they will not be available for R to use, which is another possibility. > > If you are on a *nix machine, installing should be straightforward. If you are on MacOS or Windows, you may need to get some tools. If so, you will need to see the corresponding FAQ on the R-project website. > > HTH, > > Jim > > > > -- > James W. MacDonald > Affymetrix and cDNA Microarray Core > University of Michigan Cancer Center > 1500 E. Medical Center Drive > 7410 CCGC > Ann Arbor MI 48109 > 734-647-5623 > > > > > ---------------------------------------------------------------------- > -------- This email message and any attachments are confidential and > may be privileged. If you are not the intended recipient, please notify Diversa Corporation immediately -- by replying to this message, or by sending an email to "Wenqiong Chen" <wenchen@diversa.com> -- and destroy all copies of this message and any attachments. Any review, reliance, or distribution by others or forwarding without express permission is strictly prohibited. Disclosure of confidential information without permission from its owner may be a federal crime under the Economic Espionage Act of 1996. Interception of this email is a crime under the Electronic Communications Privacy Act of 1986. > > ====================================================================== > ======== > -- James W. MacDonald Affymetrix and cDNA Microarray Core University of Michigan Cancer Center 1500 E. Medical Center Drive 7410 CCGC Ann Arbor MI 48109 734-647-5623 ---------------------------------------------------------------------- -------- This email message and any attachments are confidential and ...{{dropped}}