Hi,

first of all, a disclaimer: I know very little R .

So, now. I installed chimera on our R 3.1 and all worked fine.

Then we updated R and bioconductor to R 3.2 and bioconductor's version 3.1.  I followed the same steps to install chimera, and it is supposedly properly installed. The library loads with no errors, but now it crashes on my first script line:

> fusionevents <-importFusionData("star","../RVM_CChimeric.out.junction",org="hs",min.support=10)

The following chrs were removed from fusion acceptor:
 chrGL000191.1 chrGL000192.1 [...]

The following chrs were removed from fusion donor:
 chrGL000191.1 chrGL000192.1 [...]

Importing 8 fusions

.
Error in (function (classes, fdef, mtable)  :
  unable to find an inherited method for function ‘findOverlaps’ for signature ‘"GRanges", "NULL"’

Thanks for any help!

Kelly

SessionInfo() output

R version 3.2.0 (2015-04-16)
Platform: x86_64-redhat-linux-gnu (64-bit)
Running under: Scientific Linux release 6.5 (Carbon)

locale:
 [1] LC_CTYPE=en_US.UTF-8       LC_NUMERIC=C               LC_TIME=en_US.UTF-8        LC_COLLATE=en_US.UTF-8     LC_MONETARY=en_US.UTF-8   
 [6] LC_MESSAGES=en_US.UTF-8    LC_PAPER=en_US.UTF-8       LC_NAME=C                  LC_ADDRESS=C               LC_TELEPHONE=C            
[11] LC_MEASUREMENT=en_US.UTF-8 LC_IDENTIFICATION=C       

attached base packages:
[1] stats4    parallel  stats     graphics  grDevices utils     datasets  methods   base     

other attached packages:
 [1] BiocInstaller_1.18.3                    chimera_1.10.0                          Homo.sapiens_1.1.2                     
 [4] org.Hs.eg.db_3.1.2                      GO.db_3.1.2                             RSQLite_1.0.0                          
 [7] DBI_0.3.1                               OrganismDbi_1.10.0                      TxDb.Hsapiens.UCSC.hg19.knownGene_3.1.2
[10] GenomicFeatures_1.20.1                  BSgenome.Hsapiens.UCSC.hg19_1.4.0       BSgenome_1.36.0                        
[13] rtracklayer_1.28.4                      AnnotationDbi_1.30.1                    GenomicAlignments_1.4.1                
[16] Rsamtools_1.20.4                        Biostrings_2.36.1                       XVector_0.8.0                          
[19] GenomicRanges_1.20.5                    GenomeInfoDb_1.4.0                      IRanges_2.2.4                          
[22] S4Vectors_0.6.0                         Biobase_2.28.0                          BiocGenerics_0.14.0                    

loaded via a namespace (and not attached):
 [1] graph_1.46.0         zlibbioc_1.14.0      BiocParallel_1.2.3   tools_3.2.0          lambda.r_1.1.7       futile.logger_1.4.1  RBGL_1.44.0         
 [8] futile.options_1.0.0 bitops_1.0-6         biomaRt_2.24.0       RCurl_1.95-4.6       XML_3.98-1.2       

Hi Inge,

in my hand the example shown in vignette works:

tmp <- importFusionData("fusionmap", paste(find.package(package="chimera"),"/examples/mcf7.FMFusionReport", sep=""), org="hg19")

length(tmp)
[1] 13

> tmp[[1]]
An object of class "fSet"
Slot "fusionInfo":
$fusionTool
[1] "FusionMap"

$UniqueCuttingPositionCount
[1] "2"

$SeedCount
[1] "1"

$RescuedCount
[1] "1"

$SplicePattern
[1] "CT-AC"

$FusionGene
[1] "uc001sjr.3,uc001sjq.3->uc001bmp.4"

$frameShift
[1] "2->"

Slot "fusionLoc":
GRangesList object of length 2:
$gene1
GRanges object with 1 range and 5 metadata columns:
      seqnames               ranges strand |   KnownGene KnownTranscript KnownExonNumber KnownTranscriptStrand         FusionJunctionSequence
         <Rle>            <IRanges>  <Rle> | <character>     <character>     <character>           <character>                    <character>
  [1]     chr1 [26798973, 26799003]      - |       HMGN2      uc001bmp.4               1                     + TCCGGGGGTCGTTCTCGCCTCTTCTTCACA

$gene2
GRanges object with 1 range and 5 metadata columns:
      seqnames               ranges strand | KnownGene       KnownTranscript KnownExonNumber KnownTranscriptStrand
  [1]    chr12 [56527458, 56527488]      - |     ESYT1 uc001sjr.3,uc001sjq.3           12,12                    ++
              FusionJunctionSequence
  [1] ctgctccagtttctctgcatctgacaaaag

-------
seqinfo: 2 sequences from an unspecified genome; no seqlengths

Slot "fusionRNA":
  A DNAStringSet instance of length 0

Slot "fusionGA":
GAlignments object with 0 alignments and 0 metadata columns:
   seqnames strand       cigar    qwidth     start       end     width     njunc
      <Rle>  <Rle> <character> <integer> <integer> <integer> <integer> <integer>
  -------
  seqinfo: no sequences

> sessionInfo()
R version 3.2.2 (2015-08-14)
Platform: x86_64-apple-darwin13.4.0 (64-bit)
Running under: OS X 10.11.1 (El Capitan)

locale:
[1] en_US.UTF-8/en_US.UTF-8/en_US.UTF-8/C/en_US.UTF-8/en_US.UTF-8

attached base packages:
[1] stats4    parallel  stats     graphics  grDevices utils     datasets  methods   base     

other attached packages:
 [1] chimera_1.12.0                          Homo.sapiens_1.3.1                      org.Hs.eg.db_3.2.3                     
 [4] GO.db_3.2.2                             RSQLite_1.0.0                           DBI_0.3.1                              
 [7] OrganismDbi_1.12.0                      TxDb.Hsapiens.UCSC.hg19.knownGene_3.2.2 GenomicFeatures_1.22.5                 
[10] BSgenome.Hsapiens.UCSC.hg19_1.4.0       BSgenome_1.38.0                         rtracklayer_1.30.1                     
[13] AnnotationDbi_1.32.0                    GenomicAlignments_1.6.1                 SummarizedExperiment_1.0.1             
[16] Rsamtools_1.22.0                        Biostrings_2.38.2                       XVector_0.10.0                         
[19] GenomicRanges_1.22.1                    GenomeInfoDb_1.6.1                      IRanges_2.4.4                          
[22] S4Vectors_0.8.3                         Biobase_2.30.0                          BiocGenerics_0.16.1                    
[25] BiocInstaller_1.20.1                   

loaded via a namespace (and not attached):
 [1] graph_1.48.0         zlibbioc_1.16.0      BiocParallel_1.4.0   tools_3.2.2          lambda.r_1.1.7       futile.logger_1.4.1
 [7] RBGL_1.46.0          futile.options_1.0.0 bitops_1.0-6         biomaRt_2.26.1       RCurl_1.95-4.7       XML_3.98-1.3