Mark, Very nice to see you in Boston! Thanks for coming to the CRISPRseek session and for giving the great RNA-seq session on Thursday. I need to remove some of the requirements when users set findgRNA = FALSE. For now, here is the parameter setting that works. FYI, there is no restriction enzyme recognition site >=6 nt. I relaxed minREpatternSize = 4. library("GenomicFeatures") txdb <- makeTranscriptDbFromUCSC( ? ? ? ? ? ? ?genome="danRer7", ?tablename="refGene", ?transcript_ids=NULL, ?circ_seqs=DEFAULT_CIRC_SEQS, ?url="http://genome.ucsc.edu/cgi-bin/", ?goldenPath_url="http://hgdownload.cse.ucsc.edu/goldenPath", ?miRBaseBuild=NA) REpatternFile <- system.file("extdata", "NEBenzymes.fa",? ? ? ? ? ? ? package = "CRISPRseek") library("BSgenome.Drerio.UCSC.danRer7") library("CRISPRseek") offTargetAnalysis("pch12.fa", BSgenomeName=Drerio, findgRNAs=FALSE, outputDir="crispr_X", findPairedgRNAOnly=FALSE,max.mismatch=3, chromToSearch ="all", findgRNAsWithREcutOnly=FALSE, REpatternFile = REpatternFile, annotateExon=TRUE, txdb = txdb, minREpatternSize = 4) I will need to remove the requirements to set findPairedgRNAOnly=FALSE, findgRNAsWithREcutOnly=FALSE when findgRNAs = FALSE. Please let me know if you encounter additional problems. Thanks! Best regards, Julie ________________________________________ From: Mark Robinson [mark.robinson@imls.uzh.ch] Sent: Friday, August 01, 2014 5:11 PM To: Zhu, Lihua (Julie) Subject: bug, or did I make an error? Hi Julie, Thanks for the session today. Here is my FASTA file: mark at imlspenticton:~/scratch$ more pch12.fa >pcdh12 CACGCTCACGTAGATCATCCAGG library("BSgenome.Drerio.UCSC.danRer7") library("CRISPRseek") offTargetAnalysis("pch12.fa", BSgenomeName=Drerio, findgRNAs=FALSE, outputDir="crispr_X", max.mismatch=1, chromToSearch ="chr14", REpatternFile = REpatternFile, annotateExon=FALSE) Here is what I ran in R: > offTargetAnalysis("pch12.fa", BSgenomeName=Drerio, findgRNAs=FALSE, outputDir="crispr_X", max.mismatch=1, chromToSearch ="chr14", REpatternFile = REpatternFile, annotateExon=FALSE) Validating input ... crispr_X/ exists already. Please type 1 if you want to overwrite the outputDir and 2 if you want to exit. 1 >>> Finding all hits in sequences chr14 ... >>> DONE searching Building feature vectors for scoring ... Error in buildFeatureVectorForScoring(hits = hits, canonical.PAM = PAM, : Empty hits! In addition: Warning message: In searchHits(gRNAs = gRNAs, PAM = PAM.pattern, BSgenomeName = BSgenomeName, : No matching found, please check your input sequence, and make sure you are using the right genome. You can also alter your search criteria such as increasing max.mismatch! Cheers, Mark ------ End of Forwarded Message