Hello guest with no name, Have you tried something simple? library(ShortRead) mysequences <- readFasta('FileName.fa') Cheers, Ivan Ivan Gregoretti, PhD Bioinformatics On Fri, Mar 28, 2014 at 12:56 PM, Martin Morgan <mtmorgan@fhcrc.org> wrote: > On 03/28/2014 09:43 AM, DNAStringSet Error Biostrings in R [guest] wrote: > >> >> I posted this same quandary on Biostars and stack overflow. >> >> I am attempting to import a fasta file of sequences into R using >> Bioconductor's 'Biostrings' package and the 'DNAStringSet' function but I >> keep getting the same error: >> >> Error in .Call2("new_XString_from_CHARACTER", classname, x, >> start(solved_SEW), : >> key 112 (char 'p') not in lookup table >> >> My fasta file ("FileName.fa") is comprised of various length sequences, >> in the following format: >> >> GeneNameOne >>> >> CAGACACCCATAGATACAGATAGACAGATAGAGAAGACACCACCACACAATGA >> >>> GeneNameTwo >>> >> CGCGACATGAACCCATGATAGACGATGAGACCCCACACACACC >> ...etc >> >> I performed 'grep p FileName.fa' in the Unix terminal, but I received no >> output. >> > > you could try a divide-and-conquer approach, splitting the file into two > and read each and choose the half with a problem and continue. Please > continue reading below... > > > >> Does anyone have an idea on what is going on? >> >> Thanks in advance. >> >> -- output of sessionInfo(): >> >> Error in .Call2("new_XString_from_CHARACTER", classname, x, >> start(solved_SEW), : >> key 112 (char 'p') not in lookup table >> > > Rather than repeating the error without context, it is usually helpful to > cut-and-paste the relevant portions of the session that causes problems, > e.g., > > > library(Biostrings) > > readLines("FileName.fa", 4) ## correct file? > [1] "> GeneNameOne" > [2] "CAGACACCCATAGATACAGATAGACAGATAGAGAAGACACCACCACACAATGA" > [3] "> GeneNameTwo" > [4] "CGCGACATGAACCCATGATAGACGATGAGACCCCACACACACC" > > readDNAStringSet("FileName.fa") > > Error in .Call2("new_XString_from_CHARACTER", classname, x, > start(solved_SEW), : key 112 (char 'p') not in lookup table > > The information being asked for here is the output of the command > sessionInfo() so that basic information about your system is available; > here's mine, > > > library(Biostrings) > > sessionInfo() > R version 3.0.2 Patched (2014-01-02 r64626) > Platform: x86_64-unknown-linux-gnu (64-bit) > > locale: > [1] LC_CTYPE=en_US.UTF-8 LC_NUMERIC=C > [3] LC_TIME=en_US.UTF-8 LC_COLLATE=en_US.UTF-8 > [5] LC_MONETARY=en_US.UTF-8 LC_MESSAGES=en_US.UTF-8 > [7] LC_PAPER=en_US.UTF-8 LC_NAME=C > [9] LC_ADDRESS=C LC_TELEPHONE=C > [11] LC_MEASUREMENT=en_US.UTF-8 LC_IDENTIFICATION=C > > attached base packages: > [1] parallel stats graphics grDevices utils datasets methods > [8] base > > other attached packages: > [1] Biostrings_2.30.1 XVector_0.2.0 IRanges_1.20.6 > BiocGenerics_0.8.0 > > loaded via a namespace (and not attached): > [1] stats4_3.0.2 > > > > >> -- >> Sent via the guest posting facility at bioconductor.org. >> >> _______________________________________________ >> Bioconductor mailing list >> Bioconductor@r-project.org >> https://stat.ethz.ch/mailman/listinfo/bioconductor >> Search the archives: http://news.gmane.org/gmane. >> science.biology.informatics.conductor >> >> > > -- > Computational Biology / Fred Hutchinson Cancer Research Center > 1100 Fairview Ave. N. > PO Box 19024 Seattle, WA 98109 > > Location: Arnold Building M1 B861 > Phone: (206) 667-2793 > > > _______________________________________________ > Bioconductor mailing list > Bioconductor@r-project.org > https://stat.ethz.ch/mailman/listinfo/bioconductor > Search the archives: http://news.gmane.org/gmane. > science.biology.informatics.conductor > [[alternative HTML version deleted]]