Hi Pan, Thanks for replying. Please see attached file with first 100 lines of FinalReport.txt. Awaiting response. AK On 04/23/2013 11:53 AM, Pan Du wrote: > Hi Atul > > Can you send me to the top 100 rows of your data file? I cannot tell > the reason without seeing your data. Thanks for reporting this! > > Pan > > > Date: Mon, 22 Apr 2013 13:28:21 -0400 > From: Atul Kakrana <atulkakrana at="" outlook.com=""> <mailto:atulkakrana at="" outlook.com="">> > To: "bioconductor at r-project.org <mailto:bioconductor at="" r-project.org="">" > <bioconductor at="" r-project.org="" <mailto:bioconductor="" at="" r-project.org="">> > Subject: [BioC] Lumi problem - 'Annotation columns not available' > Message-ID: <blu0-smtp39586425625757cb11593a1adcb0 at="" phx.gbl=""> > Content-Type: text/plain; charset="ISO-8859-1" > > Hello All, > > I am trying to input the Illumina Microarray data using 'lumi' but > getting an error: > > > mydata_test <- > lumiR.batch(filename,sep='\t',convertNuID=FALSE,inputAnnotation=TRUE ,annotationColumn > = > c('PROBE_ID','ACCESSION','SYMBOL','ENTREZ_GENE_ID','PROBE_START','CH ROMOSOME')) > Inputting the data ... > Inputting the data ... > Annotation columns are not available in the data. > Perform Quality Control assessment of the LumiBatch object ... > > This error is not new to me as I had this problem before as well. But > that time I ignored it and later in analysis used 'lumiMouseAll.db' > package for annotations. The final results had incomplete (missing) > annotations. > > This time I really need complete annotations and therefore trying to > import annotations as provided by Beadstudio rather than using > 'lumiMouseAll.db'. Please tell me what is the problem as I checked all > the mentioned columns does exist in rawfile. > > >sessionInfo() > > R version 2.15.3 (2013-03-01) > Platform: x86_64-pc-linux-gnu (64-bit) > > locale: > [1] LC_CTYPE=en_US.UTF-8 LC_NUMERIC=C > LC_TIME=en_US.UTF-8 LC_COLLATE=en_US.UTF-8 > LC_MONETARY=en_US.UTF-8 LC_MESSAGES=en_US.UTF-8 > LC_PAPER=C > [8] LC_NAME=C LC_ADDRESS=C > LC_TELEPHONE=C LC_MEASUREMENT=en_US.UTF-8 > LC_IDENTIFICATION=C > > attached base packages: > [1] stats graphics grDevices utils datasets methods base > > other attached packages: > [1] lumiMouseIDMapping_1.10.0 illuminaMousev1.db_1.16.1 > illuminaMousev2.db_1.16.1 lumiMouseAll.db_1.18.0 > org.Mm.eg.db_2.8.0 calibrate_1.7.1 > scatterplot3d_0.3-33 > [8] affyQCReport_1.36.0 lattice_0.20-13 > farms_1.10.0 MASS_7.3-23 > genefilter_1.40.0 R2HTML_2.2 > annotate_1.36.0 > [15] affycoretools_1.30.0 KEGG.db_2.8.0 > affy_1.36.1 GO.db_2.8.0 > RSQLite_0.11.2 DBI_0.2-5 > AnnotationDbi_1.20.7 > [22] limma_3.14.4 lumi_2.10.0 > nleqslv_2.0 Biobase_2.18.0 > BiocGenerics_0.4.0 > > loaded via a namespace (and not attached): > [1] affyio_1.26.0 affyPLM_1.34.0 annaffy_1.30.0 > AnnotationForge_1.0.3 BiocInstaller_1.8.3 biomaRt_2.14.0 > Biostrings_2.26.3 Category_2.24.0 > [9] colorspace_1.2-1 gcrma_2.30.0 gdata_2.12.0 > GOstats_2.24.0 gplots_2.11.0 graph_1.36.2 > grid_2.15.3 GSEABase_1.20.2 > [17] gtools_2.7.0 IRanges_1.16.6 KernSmooth_2.23-10 > Matrix_1.0-11 methylumi_2.4.0 mgcv_1.7-22 > nlme_3.1-108 parallel_2.15.3 > [25] preprocessCore_1.20.0 RBGL_1.34.0 RColorBrewer_1.0-5 > RCurl_1.95-4.1 simpleaffy_2.34.0 splines_2.15.3 > stats4_2.15.3 survival_2.37-4 > [33] tools_2.15.3 XML_3.95-0.2 xtable_1.7-1 > zlibbioc_1.4.0 > > AK > -------------- next part -------------- [Header] GSGX Version 1.9.0 Report Date 7/30/2012 1:38:22 PM Project MosueWG-6 Group Set MouseWG-6 Analysis MouseWg-6 Normalization none [Sample Probe Profile] TargetID ProbeID WB1.AVG_Signal WB1.NARRAYS WB1.ARRAY_STDEV WB1.BEAD_STDERR WB1.Avg_NBEADS WB1.Detection Pval WB2.AVG_Signal WB2.NARRAYS WB2.ARRAY_STDEV WB2.BEAD_STDERR WB2.Avg_NBEADS WB2.Detection Pval T1.AVG_Signal T1.NARRAYS T1.ARRAY_STDEV T1.BEAD_STDERR T1.Avg_NBEADS T1.Detection Pval T2.AVG_Signal T2.NARRAYS T2.ARRAY_STDEV T2.BEAD_STDERR T2.Avg_NBEADS T2.Detection Pval C1.AVG_Signal C1.NARRAYS C1.ARRAY_STDEV C1.BEAD_STDERR C1.Avg_NBEADS C1.Detection Pval C2.AVG_Signal C2.NARRAYS C2.ARRAY_STDEV C2.BEAD_STDERR C2.Avg_NBEADS C2.Detection Pval SPECIES SOURCE SEARCH_KEY TRANSCRIPT ILMN_GENE SOURCE_REFERENCE_ID REFSEQ_ID UNIGENE_ID ENTREZ_GENE_ID GI ACCESSION SYMBOL PROTEIN_PRODUCT PROBE_ID ARRAY_ADDRESS_ID PROBE_TYPE PROBE_START PROBE_SEQUENCE CHROMOSOME PROBE_CHR_ORIENTATION PROBE_COORDINATES CYTOBAND DEFINITION ONTOLOGY_COMPONENT ONTOLOGY_PROCESS ONTOLOGY_FUNCTION SYNONYMS 0610005C13RIK 870465 52.7 1 NaN 3.085 37 0.17415 49.3 1 NaN 2.112 36 0.18269 43.1 1 NaN 1.636 42 0.51068 39.9 1 NaN 1.549 40 0.77137 42.3 1 NaN 1.505 50 0.50641 41.0 1 NaN 1.506 48 0.39103 Mus musculus MEEBO ILMN_184313 ILMN_184313 0610005C13RIK scl31370.6.1_3 0610005C13Rik ILMN_2417611 000870465 S 3 TTTGCAGTTCCACCCCTTACCTAGGGTGTGCGGAAGCTGGGGCGCCCCGT 0610005I04 3190307 56.4 1 NaN 2.645 48 0.08974 53.9 1 NaN 2.149 61 0.08013 49.2 1 NaN 1.811 45 0.08868 45.5 1 NaN 1.651 51 0.25641 47.9 1 NaN 1.739 58 0.10577 45.6 1 NaN 2.093 49 0.08226 Mus musculus MEEBO ILMN_223307 ILMN_223307 0610005I04 scl29691.6.1_260 NM_177579.2 31341435 NM_177579.2 0610005I04 ILMN_2762289 003190307 S 1431 TTCTGGATAGGAGAGGGGATATTGTATTGATTCACCCCATCTTGTGTCAC 0610006I08RIK 1940731 6036.0 1 NaN 150.909 47 0.00000 2725.9 1 NaN 66.145 32 0.00000 1059.1 1 NaN 33.581 43 0.00000 957.1 1 NaN 30.964 43 0.00000 1415.6 1 NaN 28.745 51 0.00000 803.0 1 NaN 16.654 42 0.00000 Mus musculus RefSeq ILMN_220369 ILMN_220369 0610006I08RIK NM_025791.1 NM_025791.1 66836 13385261 NM_025791.1 0610006I08Rik NP_080067.1 ILMN_2896528 001940731 S 521 GGCCGGCGCTTCTACTTCCTTTTGGACAAAGCTGGACACTTTCCCAACAC 19 + 8846738-8846787 19qA Mus musculus RIKEN cDNA 0610006I08 gene (0610006I08Rik), mRNA. Penetrating at least one phospholipid bilayer of a membrane. May also refer to the state of being buried in the bilayer with no exposure outside the bilayer. When used to describe a protein, indicates that all or part of the peptide sequence is embedded in the membrane [goid 16021] [evidence IEA]; Double layer of lipid molecules that encloses all cells, and, in eukaryotes, many organelles; may be a single or double lipid bilayer; also includes associated proteins [goid 16020] [evidence IEA] 0610006I08RIK 3120133 1465.3 1 NaN 34.690 31 0.00000 758.8 1 NaN 17.046 40 0.00000 332.1 1 NaN 9.985 42 0.00000 315.7 1 NaN 9.414 46 0.00000 430.4 1 NaN 15.125 28 0.00000 250.7 1 NaN 6.978 49 0.00000 Mus musculus RefSeq ILMN_220369 ILMN_220369 0610006I08RIK NM_025791.1 NM_025791.1 66836 13385261 NM_025791.1 0610006I08Rik NP_080067.1 ILMN_2721178 003120133 S 190 GACCTCCCTGGCTGTTGCAGCCTTGTCCAGACCTCTGAGCCGAGTACCTG 19 + 8845675-8845724 19qA Mus musculus RIKEN cDNA 0610006I08 gene (0610006I08Rik), mRNA. Penetrating at least one phospholipid bilayer of a membrane. May also refer to the state of being buried in the bilayer with no exposure outside the bilayer. When used to describe a protein, indicates that all or part of the peptide sequence is embedded in the membrane [goid 16021] [evidence IEA]; Double layer of lipid molecules that encloses all cells, and, in eukaryotes, many organelles; may be a single or double lipid bilayer; also includes associated proteins [goid 16020] [evidence IEA] 0610006L08RIK 2070673 40.7 1 NaN 1.463 54 0.93483 43.5 1 NaN 2.065 53 0.61111 38.0 1 NaN 1.327 47 0.92308 42.5 1 NaN 1.365 55 0.52244 43.5 1 NaN 1.624 51 0.39957 41.8 1 NaN 1.663 56 0.31624 Mus musculus MEEBO ILMN_189155 ILMN_189155 0610006L08RIK scl31173.6_20 0610006L08Rik ILMN_2458837 002070673 S 5 GGAAGCCCCGCTTCTTCAGCATAACACACGAGCTCTCAGATCTTCCAATG 0610007C21RIK 1690678 597.1 1 NaN 16.396 49 0.00000 297.3 1 NaN 7.820 44 0.00000 257.8 1 NaN 7.751 41 0.00000 230.2 1 NaN 7.652 44 0.00000 313.5 1 NaN 9.085 48 0.00000 212.2 1 NaN 6.402 41 0.00000 Mus musculus RefSeq ILMN_244468 ILMN_244468 0610007C21RIK NM_027855.2 NM_027855.2 381629 47087145 NM_027855.2 0610007C21Rik NP_082131.2 ILMN_3033922 001690678 I 139 GCTTACTGTGAGGATACATCGAAGCTAATGCAGGCCCGATGCTGCCTGAA 5 + 31351883-31351932 5qB1 Mus musculus RIKEN cDNA 0610007C21 gene (0610007C21Rik), transcript variant 1, mRNA. Penetrating at least one phospholipid bilayer of a membrane. May also refer to the state of being buried in the bilayer with no exposure outside the bilayer. When used to describe a protein, indicates that all or part of the peptide sequence is embedded in the membrane [goid 16021] [evidence IEA]; Double layer of lipid molecules that encloses all cells, and, in eukaryotes, many organelles; may be a single or double lipid bilayer; also includes associated proteins [goid 16020] [evidence IEA]; The membrane surrounding a cell that separates the cell from its external environment. It consists of a phospholipid bilayer and associated proteins [goid 5886] [evidence IEA] AI316792; HSPC013; Apr3; p18 0610007C21RIK 2710446 2529.8 1 NaN 64.796 40 0.00000 1436.5 1 NaN 35.377 42 0.00000 1110.2 1 NaN 24.380 44 0.00000 931.1 1 NaN 27.293 45 0.00000 1367.4 1 NaN 28.572 46 0.00000 800.3 1 NaN 17.807 45 0.00000 Mus musculus RefSeq ILMN_229637 ILMN_229637 0610007C21RIK NM_212470.2 NM_212470.2 381629 57526830 NM_212470.2 0610007C21Rik NP_997635.1 ILMN_3092673 002710446 A 743 ATTGCACCACCTCGGGGGTCTTGTGGACACTTGGTTCAGGAGTGGACTCG 5 + 31356894-31356943 5qB1 Mus musculus RIKEN cDNA 0610007C21 gene (0610007C21Rik), transcript variant 2, mRNA. Penetrating at least one phospholipid bilayer of a membrane. May also refer to the state of being buried in the bilayer with no exposure outside the bilayer. When used to describe a protein, indicates that all or part of the peptide sequence is embedded in the membrane [goid 16021] [evidence IEA]; Double layer of lipid molecules that encloses all cells, and, in eukaryotes, many organelles; may be a single or double lipid bilayer; also includes associated proteins [goid 16020] [evidence IEA]; The membrane surrounding a cell that separates the cell from its external environment. It consists of a phospholipid bilayer and associated proteins [goid 5886] [evidence IEA] AI316792; HSPC013; Apr3; p18 0610007C21RIK 4150678 1651.7 1 NaN 52.634 53 0.00000 1028.1 1 NaN 25.872 47 0.00000 796.4 1 NaN 22.038 44 0.00000 649.0 1 NaN 18.213 53 0.00000 861.9 1 NaN 30.448 45 0.00000 542.2 1 NaN 17.725 51 0.00000 Mus musculus RefSeq ILMN_188157 ILMN_229637 0610007C21RIK NM_212470.2 NM_212470.2 381629 57526830 NM_212470.2 0610007C21Rik NP_997635.1 ILMN_1230777 004150678 S 747 CACCACCTCGGGGGTCTTGTGGACACTTGGTTCAGGAGTGGACTCGTACT 5 + 31356898-31356947 5qB1 Mus musculus RIKEN cDNA 0610007C21 gene (0610007C21Rik), transcript variant 2, mRNA. Penetrating at least one phospholipid bilayer of a membrane. May also refer to the state of being buried in the bilayer with no exposure outside the bilayer. When used to describe a protein, indicates that all or part of the peptide sequence is embedded in the membrane [goid 16021] [evidence IEA]; Double layer of lipid molecules that encloses all cells, and, in eukaryotes, many organelles; may be a single or double lipid bilayer; also includes associated proteins [goid 16020] [evidence IEA]; The membrane surrounding a cell that separates the cell from its external environment. It consists of a phospholipid bilayer and associated proteins [goid 5886] [evidence IEA] AI316792; HSPC013; Apr3; p18 0610007J10RIK 6550717 3409.5 1 NaN 95.300 41 0.00000 1356.0 1 NaN 51.564 43 0.00000 310.5 1 NaN 10.783 48 0.00000 293.4 1 NaN 8.715 52 0.00000 383.1 1 NaN 18.237 44 0.00000 250.3 1 NaN 11.318 41 0.00000 Mus musculus Riken ILMN_202711 ILMN_202711 0610007J10RIK ri|0610007J10|R000001F05|AK018717|633 AK018717 0610007J10Rik ILMN_1246069 006550717 S 1 GGCATCCTGGGTTGGCGTAGCCATGGCGTCTCGTGTCCTCTGCGCCTGTG 0610007L01RIK 2810427 45.1 1 NaN 1.992 56 0.69551 42.6 1 NaN 1.914 48 0.71368 41.8 1 NaN 1.331 55 0.65598 44.5 1 NaN 1.880 39 0.34722 43.0 1 NaN 2.200 34 0.43697 38.2 1 NaN 1.476 52 0.66346 Mus musculus MEEBO ILMN_195645 ILMN_195645 0610007L01RIK scl27163.9.1_177 51711227 XM_355643 0610007L01Rik ILMN_1232042 002810427 S 1 GAGCCTGAGAACCTATTTAAAACAACAAATCCCACAAAGTAACACTTCAT Penetrating at least one phospholipid bilayer of a membrane. May also refer to the state of being buried in the bilayer with no exposure outside the bilayer. When used to describe a protein, indicates that all or part of the peptide sequence is embedded in the membrane [goid 16021] [evidence IEA]; Double layer of lipid molecules that encloses all cells, and, in eukaryotes, many organelles; may be a single or double lipid bilayer; also includes associated proteins [goid 16020] [evidence IEA] 0610007L01RIK 3520577 629.5 1 NaN 28.648 51 0.00000 335.4 1 NaN 13.030 53 0.00000 195.1 1 NaN 7.333 52 0.00000 171.9 1 NaN 6.792 57 0.00000 196.4 1 NaN 6.706 56 0.00000 122.2 1 NaN 3.734 62 0.00000 Mus musculus Riken ILMN_201954 ILMN_201954 0610007L01RIK ri|0610007L01|R000001M10|AK002297|1310 AK002297 0610007L01Rik ILMN_1243193 003520577 S 1104 ATTTTGCCCTGAGAAGGTGGCTCTCGTGACGCCTAATCCTACAGCTCCCC Penetrating at least one phospholipid bilayer of a membrane. May also refer to the state of being buried in the bilayer with no exposure outside the bilayer. When used to describe a protein, indicates that all or part of the peptide sequence is embedded in the membrane [goid 16021] [evidence IEA]; Double layer of lipid molecules that encloses all cells, and, in eukaryotes, many organelles; may be a single or double lipid bilayer; also includes associated proteins [goid 16020] [evidence IEA] 0610007L01RIK 7160600 45.3 1 NaN 1.654 54 0.67415 44.1 1 NaN 1.471 49 0.56731 43.0 1 NaN 1.229 61 0.53098 38.9 1 NaN 1.308 45 0.84936 40.1 1 NaN 1.613 48 0.74786 37.7 1 NaN 1.500 55 0.72115 Mus musculus MEEBO ILMN_195645 ILMN_195645 0610007L01RIK scl27163.9.1_177 51711227 XM_355643 0610007L01Rik ILMN_2524361 007160600 S 868 GGACTGGTTCCTGTGCATCTTCACTCAGTCGGTCTTCAGGTATCACACAC Penetrating at least one phospholipid bilayer of a membrane. May also refer to the state of being buried in the bilayer with no exposure outside the bilayer. When used to describe a protein, indicates that all or part of the peptide sequence is embedded in the membrane [goid 16021] [evidence IEA]; Double layer of lipid molecules that encloses all cells, and, in eukaryotes, many organelles; may be a single or double lipid bilayer; also includes associated proteins [goid 16020] [evidence IEA] 0610007N19RIK 2000424 45.3 1 NaN 1.564 62 0.67415 44.4 1 NaN 1.624 51 0.53739 44.1 1 NaN 1.350 55 0.41026 44.1 1 NaN 1.630 64 0.38248 45.7 1 NaN 1.699 58 0.21261 41.8 1 NaN 1.695 62 0.31303 Mus musculus RefSeq ILMN_203840 ILMN_310171 0610007N19RIK XM_001475444.1 XM_001475444.1 66835 149266519 XM_001475444.1 0610007N19Rik XP_001475494.1 ILMN_1242440 002000424 S 504 CTGCCTCGACTTCCCTCGTAGTACACTGAAGAGGACCCTTGGAGCAGCTC 15qB3.1 PREDICTED: Mus musculus RIKEN cDNA 0610007N19 gene (0610007N19Rik), mRNA. 0610007N19RIK 3850678 358.2 1 NaN 13.737 50 0.00000 93.1 1 NaN 4.609 45 0.00000 54.2 1 NaN 2.261 48 0.02350 51.6 1 NaN 2.109 51 0.02885 53.8 1 NaN 1.756 50 0.02137 42.4 1 NaN 1.643 44 0.25427 Mus musculus RefSeq ILMN_188213 ILMN_310171 0610007N19RIK XM_001475444.1 XM_001475444.1 66835 149266519 XM_001475444.1 0610007N19Rik XP_001475494.1 ILMN_1233188 003850678 S 1776 GATGGTTGACATAGACTGATCTACCTTCACCCACCCCAAGTGAGTTCTGC 15qB3.1 PREDICTED: Mus musculus RIKEN cDNA 0610007N19 gene (0610007N19Rik), mRNA. 0610007N19RIK 6180301 679.3 1 NaN 14.674 50 0.00000 417.2 1 NaN 11.613 59 0.00000 189.7 1 NaN 5.458 65 0.00000 159.0 1 NaN 4.567 54 0.00000 220.6 1 NaN 5.732 61 0.00000 139.7 1 NaN 4.634 52 0.00000 Mus musculus Riken ILMN_201675 ILMN_201675 0610007N19RIK ri|1810037G11|R000023J21|AK007719|212 AK007719 0610007N19Rik ILMN_2543688 006180301 S 73 GAATGGAGCAGGGAGGAGCTGAAGAGAGCGTGGCTGGGAGACATGAAGAC 0610007P08RIK 2120736 74.8 1 NaN 3.704 51 0.00534 62.7 1 NaN 2.163 52 0.02030 50.4 1 NaN 1.920 66 0.06624 49.3 1 NaN 1.724 46 0.07692 45.9 1 NaN 1.682 53 0.19979 37.9 1 NaN 1.618 50 0.70085 Mus musculus RefSeq ILMN_207376 ILMN_196322 0610007P08RIK NM_023507.3 NM_023507.3 76251 91807127 NM_023507.3 0610007P08Rik NP_075996.2 ILMN_1259789 002120736 S 1372 CTCACATCCTCTCAGCCTTGTACCTGTGGCAGTGGCCAGAAGCGCAGAAA 13 + 63945932-63945981 13qB3 Mus musculus RIKEN cDNA 0610007P08 gene (0610007P08Rik), transcript variant 2, mRNA. A membrane- bounded organelle of eukaryotic cells in which chromosomes are housed and replicated. In most cells, the nucleus contains all of the cell's chromosomes except the organellar chromosomes, and is the site of RNA synthesis and processing. In some species, or in specialized cell types, RNA metabolism or DNA replication may be absent [goid 5634] [evidence IEA] The process of restoring DNA after damage. Genomes are subject to damage by chemical and physical agents in the environment (e.g. UV and ionizing radiations, chemical mutagens, fungal and bacterial toxins, etc.) and by free radicals or alkylating agents endogenously generated in metabolism. DNA is also damaged because of errors during its replication. A variety of different DNA repair pathways have been reported that include direct reversal, base excision repair, nucleotide excision repair, photoreactivation, bypass, double-strand break repair pathway, and mismatch repair pathway [goid 6281] [evidence IEA]; A change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a stimulus indicating damage to its DNA from environmental insults or errors during metabolism [goid 6974] [evidence IEA] Catalysis of the hydrolysis of various bonds, e.g. C-O, C-N, C-C, phosphoric anhydride bonds, etc. Hydrolase is the systematic name for any enzyme of EC class 3 [goid 16787] [evidence IEA]; Catalysis of the reaction: NTP + H2O = NDP + phosphate to drive the unwinding of a DNA or RNA helix [goid 4386] [evidence IEA]; Interacting selectively with DNA (deoxyribonucleic acid) [goid 3677] [evidence IEA]; Interacting selectively with a nucleotide, any compound consisting of a nucleoside that is esterified with (ortho)phosphate or an oligophosphate at any hydroxyl group on the ribose or deoxyribose moiety [goid 166] [evidence IEA]; Interacting selectively with ATP, adenosine 5'-triphosphate, a universally important coenzyme and enzyme regulator [goid 5524] [evidence IEA]; Interacting selectively with any nucleic acid [goid 3676] [evidence IEA]; Catalysis of the reaction: ATP + H2O = ADP + phosphate to drive the unwinding of a DNA or RNA helix [goid 8026] [evidence IEA] RAD26L; 1700019D06Rik 0610007P08RIK 4610239 70.7 1 NaN 3.071 42 0.00962 55.5 1 NaN 1.952 42 0.06517 42.0 1 NaN 1.996 32 0.63889 43.2 1 NaN 1.577 35 0.46368 42.6 1 NaN 1.599 41 0.48611 33.4 1 NaN 1.916 21 0.97650 Mus musculus RefSeq ILMN_196322 ILMN_196322 0610007P08RIK NM_023507.3 NM_023507.3 76251 91807127 NM_023507.3 0610007P08Rik NP_075996.2 ILMN_2816356 004610239 S 2173 GGTGTCCACAACCTCTTCAAACTAAGGTCCCAAGGGTCATGTCTTACGAG 13 + 63970424-63970473 13qB3 Mus musculus RIKEN cDNA 0610007P08 gene (0610007P08Rik), transcript variant 2, mRNA. A membrane- bounded organelle of eukaryotic cells in which chromosomes are housed and replicated. In most cells, the nucleus contains all of the cell's chromosomes except the organellar chromosomes, and is the site of RNA synthesis and processing. In some species, or in specialized cell types, RNA metabolism or DNA replication may be absent [goid 5634] [evidence IEA] The process of restoring DNA after damage. Genomes are subject to damage by chemical and physical agents in the environment (e.g. UV and ionizing radiations, chemical mutagens, fungal and bacterial toxins, etc.) and by free radicals or alkylating agents endogenously generated in metabolism. DNA is also damaged because of errors during its replication. A variety of different DNA repair pathways have been reported that include direct reversal, base excision repair, nucleotide excision repair, photoreactivation, bypass, double-strand break repair pathway, and mismatch repair pathway [goid 6281] [evidence IEA]; A change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a stimulus indicating damage to its DNA from environmental insults or errors during metabolism [goid 6974] [evidence IEA] Catalysis of the hydrolysis of various bonds, e.g. C-O, C-N, C-C, phosphoric anhydride bonds, etc. Hydrolase is the systematic name for any enzyme of EC class 3 [goid 16787] [evidence IEA]; Catalysis of the reaction: NTP + H2O = NDP + phosphate to drive the unwinding of a DNA or RNA helix [goid 4386] [evidence IEA]; Interacting selectively with DNA (deoxyribonucleic acid) [goid 3677] [evidence IEA]; Interacting selectively with a nucleotide, any compound consisting of a nucleoside that is esterified with (ortho)phosphate or an oligophosphate at any hydroxyl group on the ribose or deoxyribose moiety [goid 166] [evidence IEA]; Interacting selectively with ATP, adenosine 5'-triphosphate, a universally important coenzyme and enzyme regulator [goid 5524] [evidence IEA]; Interacting selectively with any nucleic acid [goid 3676] [evidence IEA]; Catalysis of the reaction: ATP + H2O = ADP + phosphate to drive the unwinding of a DNA or RNA helix [goid 8026] [evidence IEA] RAD26L; 1700019D06Rik 0610007P08RIK 5420050 103.5 1 NaN 3.679 57 0.00000 72.9 1 NaN 2.368 45 0.00321 49.6 1 NaN 1.568 41 0.07906 44.3 1 NaN 1.451 62 0.35897 48.1 1 NaN 2.081 51 0.09936 40.7 1 NaN 1.347 60 0.41667 Mus musculus MEEBO ILMN_219797 ILMN_219797 0610007P08RIK scl0076251.1_236 51767744 XM_484269 0610007P08Rik ILMN_1224596 005420050 S 3044 GTGGCAGAGGGAATGGACCAGTTCCAAATCTCTTGTGTCTCGAGAACATG A membrane-bounded organelle of eukaryotic cells in which chromosomes are housed and replicated. In most cells, the nucleus contains all of the cell's chromosomes except the organellar chromosomes, and is the site of RNA synthesis and processing. In some species, or in specialized cell types, RNA metabolism or DNA replication may be absent [goid 5634] [evidence IEA] The process of restoring DNA after damage. Genomes are subject to damage by chemical and physical agents in the environment (e.g. UV and ionizing radiations, chemical mutagens, fungal and bacterial toxins, etc.) and by free radicals or alkylating agents endogenously generated in metabolism. DNA is also damaged because of errors during its replication. A variety of different DNA repair pathways have been reported that include direct reversal, base excision repair, nucleotide excision repair, photoreactivation, bypass, double-strand break repair pathway, and mismatch repair pathway [goid 6281] [evidence IEA]; A change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a stimulus indicating damage to its DNA from environmental insults or errors during metabolism [goid 6974] [evidence IEA] Catalysis of the hydrolysis of various bonds, e.g. C-O, C-N, C-C, phosphoric anhydride bonds, etc. Hydrolase is the systematic name for any enzyme of EC class 3 [goid 16787] [evidence IEA]; Catalysis of the reaction: NTP + H2O = NDP + phosphate to drive the unwinding of a DNA or RNA helix [goid 4386] [evidence IEA]; Interacting selectively with DNA (deoxyribonucleic acid) [goid 3677] [evidence IEA]; Interacting selectively with a nucleotide, any compound consisting of a nucleoside that is esterified with (ortho)phosphate or an oligophosphate at any hydroxyl group on the ribose or deoxyribose moiety [goid 166] [evidence IEA]; Interacting selectively with ATP, adenosine 5'-triphosphate, a universally important coenzyme and enzyme regulator [goid 5524] [evidence IEA]; Interacting selectively with any nucleic acid [goid 3676] [evidence IEA]; Catalysis of the reaction: ATP + H2O = ADP + phosphate to drive the unwinding of a DNA or RNA helix [goid 8026] [evidence IEA] 0610007P08RIK 6900500 49.7 1 NaN 2.006 63 0.31838 46.9 1 NaN 1.160 59 0.30235 42.8 1 NaN 1.209 57 0.55021 42.2 1 NaN 1.453 51 0.54167 43.9 1 NaN 1.426 68 0.35363 42.3 1 NaN 1.792 43 0.26282 Mus musculus RefSeq ILMN_196322 ILMN_196322 0610007P08RIK NM_023507.2 NM_023507.2 31340591 NM_023507.2 0610007P08Rik ILMN_1233643 006900500 S 1007 CAGTAACGCAAGTCAGCTGCAAGTCTCCTCATTCATCTTTGCCCAACACG A membrane-bounded organelle of eukaryotic cells in which chromosomes are housed and replicated. In most cells, the nucleus contains all of the cell's chromosomes except the organellar chromosomes, and is the site of RNA synthesis and processing. In some species, or in specialized cell types, RNA metabolism or DNA replication may be absent [goid 5634] [evidence IEA] The process of restoring DNA after damage. Genomes are subject to damage by chemical and physical agents in the environment (e.g. UV and ionizing radiations, chemical mutagens, fungal and bacterial toxins, etc.) and by free radicals or alkylating agents endogenously generated in metabolism. DNA is also damaged because of errors during its replication. A variety of different DNA repair pathways have been reported that include direct reversal, base excision repair, nucleotide excision repair, photoreactivation, bypass, double-strand break repair pathway, and mismatch repair pathway [goid 6281] [evidence IEA]; A change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a stimulus indicating damage to its DNA from environmental insults or errors during metabolism [goid 6974] [evidence IEA] Catalysis of the hydrolysis of various bonds, e.g. C-O, C-N, C-C, phosphoric anhydride bonds, etc. Hydrolase is the systematic name for any enzyme of EC class 3 [goid 16787] [evidence IEA]; Catalysis of the reaction: NTP + H2O = NDP + phosphate to drive the unwinding of a DNA or RNA helix [goid 4386] [evidence IEA]; Interacting selectively with DNA (deoxyribonucleic acid) [goid 3677] [evidence IEA]; Interacting selectively with a nucleotide, any compound consisting of a nucleoside that is esterified with (ortho)phosphate or an oligophosphate at any hydroxyl group on the ribose or deoxyribose moiety [goid 166] [evidence IEA]; Interacting selectively with ATP, adenosine 5'-triphosphate, a universally important coenzyme and enzyme regulator [goid 5524] [evidence IEA]; Interacting selectively with any nucleic acid [goid 3676] [evidence IEA]; Catalysis of the reaction: ATP + H2O = ADP + phosphate to drive the unwinding of a DNA or RNA helix [goid 8026] [evidence IEA] 0610007P14RIK 1230730 1447.4 1 NaN 37.610 36 0.00000 669.6 1 NaN 22.330 35 0.00000 93.6 1 NaN 4.668 39 0.00000 101.1 1 NaN 4.059 31 0.00000 93.4 1 NaN 4.093 29 0.00000 76.5 1 NaN 3.079 43 0.00000 Mus musculus RefSeq ILMN_239772 ILMN_239772 0610007P14RIK NM_021446.1 NM_021446.1 58520 10946821 NM_021446.1 0610007P14Rik NP_067421.1 ILMN_2808939 001230730 S 963 GGGCACAGGGCTGCTTCAAGGTCCTGAGCACATAGACTGGGCTCCTTTCT 12 - 86704730-86704779 12qD2 Mus musculus RIKEN cDNA 0610007P14 gene (0610007P14Rik), mRNA. The irregular network of unit membranes, visible only by electron microscopy, that occurs in the cytoplasm of many eukaryotic cells. The membranes form a complex meshwork of tubular channels, which are often expanded into slitlike cavities called cisternae. The ER takes two forms, rough (or granular), with ribosomes adhering to the outer surface, and smooth (with no ribosomes attached) [goid 5783] [evidence IEA]; Penetrating at least one phospholipid bilayer of a membrane. May also refer to the state of being buried in the bilayer with no exposure outside the bilayer. When used to describe a protein, indicates that all or part of the peptide sequence is embedded in the membrane [goid 16021] [evidence IEA]; Double layer of lipid molecules that encloses all cells, and, in eukaryotes, many organelles; may be a single or double lipid bilayer; also includes associated proteins [goid 16020] [evidence IEA] The chemical reactions and pathways resulting in the formation of sterols, steroids with one or more hydroxyl groups and a hydrocarbon side-chain in the molecule [goid 16126] [evidence IEA]; The chemical reactions and pathways resulting in the formation of steroids, compounds with a 1,2,cyclopentanoperhydrophenanthrene nucleus; includes de novo formation and steroid interconversion by modification [goid 6694] [evidence IEA]; The chemical reactions and pathways resulting in the formation of lipids, compounds soluble in an organic solvent but not, or sparingly, in an aqueous solvent [goid 8610] [evidence IEA] AU019315; C77855; 1190004E09Rik; ORF11 0610007P14RIK 4150367 1194.8 1 NaN 34.113 39 0.00000 513.6 1 NaN 11.807 47 0.00000 79.5 1 NaN 2.239 51 0.00000 81.6 1 NaN 2.059 50 0.00000 90.4 1 NaN 2.926 46 0.00000 71.3 1 NaN 1.922 59 0.00000 Mus musculus RefSeq ILMN_223911 ILMN_239772 0610007P14RIK NM_021446.2 NM_021446.2 58520 133892239 NM_021446.2 0610007P14Rik NP_067421.1 ILMN_2771349 004150367 S 8 GGAGCTGGCCTAGGGAGAGCTGGTTTGCGGATGCTGCTGATACTGCTGCA 12 - 87165438-87165487 12qD2 Mus musculus RIKEN cDNA 0610007P14 gene (0610007P14Rik), mRNA. The irregular network of unit membranes, visible only by electron microscopy, that occurs in the cytoplasm of many eukaryotic cells. The membranes form a complex meshwork of tubular channels, which are often expanded into slitlike cavities called cisternae. The ER takes two forms, rough (or granular), with ribosomes adhering to the outer surface, and smooth (with no ribosomes attached) [goid 5783] [evidence IEA]; Penetrating at least one phospholipid bilayer of a membrane. May also refer to the state of being buried in the bilayer with no exposure outside the bilayer. When used to describe a protein, indicates that all or part of the peptide sequence is embedded in the membrane [goid 16021] [evidence IEA]; Double layer of lipid molecules that encloses all cells, and, in eukaryotes, many organelles; may be a single or double lipid bilayer; also includes associated proteins [goid 16020] [evidence IEA] The chemical reactions and pathways resulting in the formation of sterols, steroids with one or more hydroxyl groups and a hydrocarbon side-chain in the molecule [goid 16126] [evidence IEA]; The chemical reactions and pathways resulting in the formation of steroids, compounds with a 1,2,cyclopentanoperhydrophenanthrene nucleus; includes de novo formation and steroid interconversion by modification [goid 6694] [evidence IEA]; The chemical reactions and pathways resulting in the formation of lipids, compounds soluble in an organic solvent but not, or sparingly, in an aqueous solvent [goid 8610] [evidence IEA] AU019315; C77855; 1190004E09Rik; ORF11 0610007P14RIK 4490064 1711.7 1 NaN 54.126 57 0.00000 780.2 1 NaN 19.808 65 0.00000 100.6 1 NaN 3.023 60 0.00000 104.8 1 NaN 3.326 54 0.00000 101.5 1 NaN 3.209 49 0.00000 76.3 1 NaN 2.857 65 0.00000 Mus musculus RefSeq ILMN_223911 ILMN_239772 0610007P14RIK NM_021446.2 NM_021446.2 58520 133892239 NM_021446.2 0610007P14Rik NP_067421.1 ILMN_2773981 004490064 S 964 GGGCAAGGGCTGCTTCAAGGTCCTGAGCACATAGACTGGGCTCCTTTCTA 12 - 87156576-87156625 12qD2 Mus musculus RIKEN cDNA 0610007P14 gene (0610007P14Rik), mRNA. The irregular network of unit membranes, visible only by electron microscopy, that occurs in the cytoplasm of many eukaryotic cells. The membranes form a complex meshwork of tubular channels, which are often expanded into slitlike cavities called cisternae. The ER takes two forms, rough (or granular), with ribosomes adhering to the outer surface, and smooth (with no ribosomes attached) [goid 5783] [evidence IEA]; Penetrating at least one phospholipid bilayer of a membrane. May also refer to the state of being buried in the bilayer with no exposure outside the bilayer. When used to describe a protein, indicates that all or part of the peptide sequence is embedded in the membrane [goid 16021] [evidence IEA]; Double layer of lipid molecules that encloses all cells, and, in eukaryotes, many organelles; may be a single or double lipid bilayer; also includes associated proteins [goid 16020] [evidence IEA] The chemical reactions and pathways resulting in the formation of sterols, steroids with one or more hydroxyl groups and a hydrocarbon side-chain in the molecule [goid 16126] [evidence IEA]; The chemical reactions and pathways resulting in the formation of steroids, compounds with a 1,2,cyclopentanoperhydrophenanthrene nucleus; includes de novo formation and steroid interconversion by modification [goid 6694] [evidence IEA]; The chemical reactions and pathways resulting in the formation of lipids, compounds soluble in an organic solvent but not, or sparingly, in an aqueous solvent [goid 8610] [evidence IEA] AU019315; C77855; 1190004E09Rik; ORF11 0610007P22RIK 1070170 771.6 1 NaN 33.840 40 0.00000 421.9 1 NaN 12.838 35 0.00000 80.0 1 NaN 3.480 38 0.00000 70.1 1 NaN 2.393 36 0.00000 80.9 1 NaN 3.716 54 0.00000 53.6 1 NaN 2.435 30 0.00855 Mus musculus RefSeq ILMN_213192 ILMN_213192 0610007P22RIK NM_026676.1 NM_026676.1 68327 21489946 NM_026676.1 0610007P22Rik NP_080952.1 ILMN_2634564 001070170 S 1050 CTGGTGTGCATTATTCAGAAGTGGCAGTAGGACCTGGGGATGGACGGGCC 17 + 24970285-24970334 17qA3.3 Mus musculus RIKEN cDNA 0610007P22 gene (0610007P22Rik), mRNA. Penetrating at least one phospholipid bilayer of a membrane. May also refer to the state of being buried in the bilayer with no exposure outside the bilayer. When used to describe a protein, indicates that all or part of the peptide sequence is embedded in the membrane [goid 16021] [evidence IEA]; Double layer of lipid molecules that encloses all cells, and, in eukaryotes, many organelles; may be a single or double lipid bilayer; also includes associated proteins [goid 16020] [evidence IEA] AL022759; MGC113771; 1110014B11Rik 0610007P22RIK 3870091 129.1 1 NaN 4.432 57 0.00000 356.0 1 NaN 10.194 59 0.00000 121.6 1 NaN 2.969 60 0.00000 107.1 1 NaN 2.520 64 0.00000 105.4 1 NaN 2.870 68 0.00000 111.9 1 NaN 4.031 51 0.00000 Mus musculus MEEBO ILMN_186494 ILMN_186494 0610007P22RIK scl000093.1_57 0610007P22Rik ILMN_2435996 003870091 S 5 CCATCCCCAGGTCCTACTGCCACTTCTGAATAATGCACACCAGCTTCAAT Penetrating at least one phospholipid bilayer of a membrane. May also refer to the state of being buried in the bilayer with no exposure outside the bilayer. When used to describe a protein, indicates that all or part of the peptide sequence is embedded in the membrane [goid 16021] [evidence IEA]; Double layer of lipid molecules that encloses all cells, and, in eukaryotes, many organelles; may be a single or double lipid bilayer; also includes associated proteins [goid 16020] [evidence IEA] 0610007P22RIK 6590561 131.4 1 NaN 4.066 55 0.00000 351.9 1 NaN 7.615 64 0.00000 118.1 1 NaN 2.833 70 0.00000 109.6 1 NaN 2.720 60 0.00000 106.8 1 NaN 2.048 62 0.00000 113.2 1 NaN 2.935 70 0.00000 Mus musculus RefSeq ILMN_191546 ILMN_213192 0610007P22RIK NM_026676.2 NM_026676.2 68327 142372926 NM_026676.2 0610007P22Rik NP_080952.1 ILMN_2480021 006590561 S 1103 AGCAGGCCCGTCCATCCCCAGGTCCTACTGCCACTTCTGAATAATGCACA 17 + 25379683-25379732 17qA3.3 Mus musculus RIKEN cDNA 0610007P22 gene (0610007P22Rik), mRNA. Penetrating at least one phospholipid bilayer of a membrane. May also refer to the state of being buried in the bilayer with no exposure outside the bilayer. When used to describe a protein, indicates that all or part of the peptide sequence is embedded in the membrane [goid 16021] [evidence IEA]; Double layer of lipid molecules that encloses all cells, and, in eukaryotes, many organelles; may be a single or double lipid bilayer; also includes associated proteins [goid 16020] [evidence IEA] AL022759; MGC113771; 1110014B11Rik 0610008C08RIK 2630593 55.0 1 NaN 3.976 25 0.10684 51.5 1 NaN 2.370 43 0.11859 44.7 1 NaN 1.824 39 0.35043 39.3 1 NaN 1.538 36 0.81517 40.7 1 NaN 1.620 27 0.66774 38.8 1 NaN 1.918 30 0.59722 Mus musculus RefSeq ILMN_221600 ILMN_221600 0610008C08RIK NM_026673.2 NM_026673.2 68316 142368551 NM_026673.2 0610008C08Rik NP_080949.1 ILMN_2737647 002630593 S 279 CGTGCCCACCTCCTCGGCTAATGCCCTTTTGGGGTTGTGGGGAGGATGAA X + 91612771-91612789:91612790-91612820 XqC3 Mus musculus RIKEN cDNA 0610008C08 gene (0610008C08Rik), mRNA. RP23-272D10.2; MGC130105; MGC130106; 1110019O03Rik 0610008F07RIK 4540673 54.2 1 NaN 2.460 47 0.12714 57.0 1 NaN 2.430 61 0.05235 47.9 1 NaN 1.589 53 0.13568 47.0 1 NaN 1.808 50 0.16453 48.3 1 NaN 1.437 52 0.09509 40.9 1 NaN 1.317 50 0.39423 Mus musculus MEEBO ILMN_222101 ILMN_222101 0610008F07RIK scl18383.5.1_228 NM_197983.1 37574055 NM_197983.1 0610008F07Rik ILMN_1236537 004540673 S 706 CACCTGTTGGGGCTAGTGCCATCGATATTGCCCGTGCTCAATTAAATATG 0610009B14RIK 1170687 49.0 1 NaN 3.481 40 0.36004 43.1 1 NaN 3.007 39 0.65064 36.4 1 NaN 1.545 43 0.96688 33.7 1 NaN 1.386 46 0.99893 34.5 1 NaN 1.643 38 0.99038 33.9 1 NaN 1.496 46 0.96688 Mus musculus MEEBO ILMN_221704 ILMN_221704 0610009B14RIK scl42290.2.1_321 XM_127006.1 20909473 XM_127006.1 0610009B14Rik ILMN_2739275 001170687 S 863 CAGACCTCTCAGAAATGCTTATGATGCTGTCCCTTGAGGGTACTATGTGG 0610009B22RIK 6280440 476.7 1 NaN 22.604 48 0.00000 202.9 1 NaN 9.803 45 0.00000 90.2 1 NaN 4.553 36 0.00000 96.2 1 NaN 4.653 48 0.00000 104.6 1 NaN 4.795 43 0.00000 76.5 1 NaN 3.532 49 0.00000 Mus musculus RefSeq ILMN_221361 ILMN_221361 0610009B22RIK NM_025319.2 NM_025319.2 66050 141801968 NM_025319.2 0610009B22Rik NP_079595.1 ILMN_2734484 006280440 S 403 TCTTCACTGACGTCTACGACTTATACATCAAATTTGCCATGAATCCCTTT 11 - 51499229-51499278 11qB1.3 Mus musculus RIKEN cDNA 0610009B22 gene (0610009B22Rik), mRNA. RP23-79E13.7 0610009D07RIK 3060092 181.6 1 NaN 6.447 45 0.00000 110.9 1 NaN 3.748 47 0.00000 54.4 1 NaN 2.108 38 0.02244 55.6 1 NaN 2.463 36 0.00534 62.3 1 NaN 2.105 57 0.00214 51.9 1 NaN 2.218 43 0.01496 Mus musculus RefSeq ILMN_218698 ILMN_218698 0610009D07RIK NM_025323.2 NM_025323.2 66055 31981274 NM_025323.2 0610009D07Rik NP_079599.1 ILMN_2952292 003060092 S 1065 CTTGCCTTGGTCATGATGTCTGCTCACAGCCTTAAAACCCTTAAAACACT 12 + 4834414-4834463 12qA1.1 Mus musculus RIKEN cDNA 0610009D07 gene (0610009D07Rik), mRNA. A membrane-bounded organelle of eukaryotic cells in which chromosomes are housed and replicated. In most cells, the nucleus contains all of the cell's chromosomes except the organellar chromosomes, and is the site of RNA synthesis and processing. In some species, or in specialized cell types, RNA metabolism or DNA replication may be absent [goid 5634] [evidence IEA] Any process involved in the conversion of a primary mRNA transcript into one or more mature mRNA(s) prior to translation into polypeptide [goid 6397] [evidence IEA]; The process of removing sections of the primary RNA transcript to remove sequences not present in the mature form of the RNA and joining the remaining sections to form the mature form of the RNA [goid 8380] [evidence IEA] Interacting selectively with an RNA molecule or a portion thereof [goid 3723] [evidence IEA]; Interacting selectively with any nucleic acid [goid 3676] [evidence IEA]; Interacting selectively with a nucleotide, any compound consisting of a nucleoside that is esterified with (ortho)phosphate or an oligophosphate at any hydroxyl group on the ribose or deoxyribose moiety [goid 166] [evidence IEA] 6030419K15Rik; AV001342; Sf3b14 0610009D07RIK 6290215 47.2 1 NaN 1.386 58 0.49359 48.1 1 NaN 2.275 40 0.23077 45.2 1 NaN 1.673 41 0.31410 43.8 1 NaN 1.831 39 0.41346 45.3 1 NaN 1.707 38 0.23932 41.2 1 NaN 1.785 39 0.37179 Mus musculus RefSeq ILMN_218698 ILMN_218698 0610009D07RIK NM_025323.2 NM_025323.2 66055 31981274 NM_025323.2 0610009D07Rik NP_079599.1 ILMN_2699078 006290215 S 608 TTAATTAGTACTGAATATTGTGATTTCTTATTTGAGAACTAGAATGACTT 12 + 4833957-4834006 12qA1.1 Mus musculus RIKEN cDNA 0610009D07 gene (0610009D07Rik), mRNA. A membrane-bounded organelle of eukaryotic cells in which chromosomes are housed and replicated. In most cells, the nucleus contains all of the cell's chromosomes except the organellar chromosomes, and is the site of RNA synthesis and processing. In some species, or in specialized cell types, RNA metabolism or DNA replication may be absent [goid 5634] [evidence IEA] Any process involved in the conversion of a primary mRNA transcript into one or more mature mRNA(s) prior to translation into polypeptide [goid 6397] [evidence IEA]; The process of removing sections of the primary RNA transcript to remove sequences not present in the mature form of the RNA and joining the remaining sections to form the mature form of the RNA [goid 8380] [evidence IEA] Interacting selectively with an RNA molecule or a portion thereof [goid 3723] [evidence IEA]; Interacting selectively with any nucleic acid [goid 3676] [evidence IEA]; Interacting selectively with a nucleotide, any compound consisting of a nucleoside that is esterified with (ortho)phosphate or an oligophosphate at any hydroxyl group on the ribose or deoxyribose moiety [goid 166] [evidence IEA] 6030419K15Rik; AV001342; Sf3b14 0610009D07RIK 6450369 52.0 1 NaN 2.762 45 0.20620 49.9 1 NaN 1.580 46 0.16239 40.4 1 NaN 1.517 53 0.79060 37.7 1 NaN 1.193 52 0.93376 39.1 1 NaN 1.568 57 0.82799 39.4 1 NaN 1.432 57 0.53419 Mus musculus Riken ILMN_202655 ILMN_202655 0610009D07RIK ri|6030419K15|PX00056I06|AK020052|746 AK020052 0610009D07Rik ILMN_2551266 006450369 S 256 GCGAATGTGAGTACCCCGCTTTTTGCGTGACAGGGAAGCGATGTTGTTGC A membrane-bounded organelle of eukaryotic cells in which chromosomes are housed and replicated. In most cells, the nucleus contains all of the cell's chromosomes except the organellar chromosomes, and is the site of RNA synthesis and processing. In some species, or in specialized cell types, RNA metabolism or DNA replication may be absent [goid 5634] [evidence IEA] Any process involved in the conversion of a primary mRNA transcript into one or more mature mRNA(s) prior to translation into polypeptide [goid 6397] [evidence IEA]; The process of removing sections of the primary RNA transcript to remove sequences not present in the mature form of the RNA and joining the remaining sections to form the mature form of the RNA [goid 8380] [evidence IEA] Interacting selectively with an RNA molecule or a portion thereof [goid 3723] [evidence IEA]; Interacting selectively with any nucleic acid [goid 3676] [evidence IEA]; Interacting selectively with a nucleotide, any compound consisting of a nucleoside that is esterified with (ortho)phosphate or an oligophosphate at any hydroxyl group on the ribose or deoxyribose moiety [goid 166] [evidence IEA] 0610009J05RIK 110403 234.2 1 NaN 7.467 47 0.00000 81.9 1 NaN 2.366 46 0.00107 38.5 1 NaN 1.475 47 0.91239 38.8 1 NaN 1.416 49 0.85791 38.0 1 NaN 1.679 50 0.89103 35.3 1 NaN 1.309 44 0.91132 Mus musculus Riken ILMN_202257 ILMN_202257 0610009J05RIK ri|0610009J05|R000002G03|AK002411|1570 AK002411 0610009J05Rik ILMN_1257639 000110403 S 1412 TAAAAGAAGTGGGTGTTAGCCGGGCAGTGTTGGCGCATACCTTTAATCCC 0610009L18RIK 6450296 57.9 1 NaN 2.548 42 0.07692 51.4 1 NaN 2.007 59 0.11966 47.8 1 NaN 2.088 42 0.14103 47.9 1 NaN 1.765 66 0.12073 50.5 1 NaN 1.778 48 0.04487 47.8 1 NaN 1.805 46 0.03205 Mus musculus MEEBO ILMN_191701 ILMN_191701 0610009L18RIK scl40636.2.1_9 0610009L18Rik ILMN_1233543 006450296 S 1 GCTGACGTTACAGTGTAATGAGTGAACTCCTCTGATGTCTTTGAAACTTT 0610009O04RIK 3390392 69.0 1 NaN 2.639 60 0.01389 52.8 1 NaN 1.872 58 0.09722 47.2 1 NaN 1.803 57 0.17735 46.9 1 NaN 2.081 40 0.16774 48.0 1 NaN 1.740 41 0.10256 45.8 1 NaN 1.849 55 0.07479 Mus musculus Riken ILMN_202256 ILMN_202256 0610009O04RIK ri|0610009O04|R000002E21|AK002431|1349 AK002431 0610009O04Rik ILMN_1222927 003390392 S 1271 GGGAAGTGGGGTGGGGCCATCGATCAGTAGTAGAGCGTTTACCTAGCATG 0610009O20RIK 2900228 659.5 1 NaN 16.097 52 0.00000 271.8 1 NaN 7.213 42 0.00000 86.9 1 NaN 3.514 43 0.00000 83.2 1 NaN 2.575 53 0.00000 89.5 1 NaN 3.046 42 0.00000 73.3 1 NaN 3.193 42 0.00000 Mus musculus RefSeq ILMN_220613 ILMN_220613 0610009O20RIK NM_024179.4 NM_024179.4 66839 142383028 NM_024179.4 0610009O20Rik NP_077141.2 ILMN_1213681 002900228 S 1911 CTCCTTGCTTAGGTTCCTGAAGACAGACTGGTGCCCACAGTTCCATGGCC 18 + 38421800-38421849 18qB3 Mus musculus RIKEN cDNA 0610009O20 gene (0610009O20Rik), mRNA. The selective, often stoichiometric, interaction of a molecule with one or more specific sites on another molecule [goid 5488] [evidence IEA] 2700004E22Rik 0610010D20RIK 2850424 52.8 1 NaN 3.101 37 0.17308 42.4 1 NaN 1.862 41 0.73397 38.6 1 NaN 1.935 35 0.91026 41.8 1 NaN 1.787 36 0.60150 38.2 1 NaN 2.041 35 0.87821 36.9 1 NaN 1.567 26 0.79808 Mus musculus RefSeq ILMN_221425 ILMN_221425 0610010D20RIK NM_026152.1 NM_026152.1 67432 13385655 NM_026152.1 0610010D20Rik NP_080428.1 ILMN_2735413 002850424 S 911 TGAAGAAAACCATGGACTGGTTTGGCTACTATGGAGGTCCCTGCCGCGCC 19 + 42144705-42144754 19qC3 Mus musculus RIKEN cDNA 0610010D20 gene (0610010D20Rik), mRNA. A semiautonomous, self replicating organelle that occurs in varying numbers, shapes, and sizes in the cytoplasm of virtually all eukaryotic cells. It is notably the site of tissue respiration [goid 5739] [evidence IDA] The chemical reactions and pathways, including anabolism and catabolism, by which living organisms transform chemical substances. Metabolic processes typically transform small molecules, but also include macromolecular processes such as DNA repair and replication, and protein synthesis and degradation [goid 8152] [evidence IEA] Catalysis of the cleavage of C-C, C-O, C-N and other bonds by other means than by hydrolysis or oxidation, or conversely adding a group to a double bond. They differ from other enzymes in that two substrates are involved in one reaction direction, but only one in the other direction. When acting on the single substrate, a molecule is eliminated and this generates either a new double bond or a new ring [goid 16829] [evidence IEA]; Catalysis of a biochemical reaction at physiological temperatures. In biologically catalyzed reactions, the reactants are known as substrates, and the catalysts are naturally occurring macromolecular substances known as enzymes. Enzymes possess specific binding sites for substrates, and are usually composed wholly or largely of protein, but RNA that has catalytic activity (ribozyme) is often also regarded as enzymatic [goid 3824] [evidence IEA] 0610010D20RIK 3190008 60.4 1 NaN 2.916 48 0.04808 54.3 1 NaN 2.639 36 0.07479 41.8 1 NaN 1.891 40 0.65598 37.8 1 NaN 1.409 36 0.92842 44.8 1 NaN 1.870 36 0.28419 41.4 1 NaN 1.781 44 0.36004 Mus musculus RefSeq ILMN_221425 ILMN_221425 0610010D20RIK NM_026152.1 NM_026152.1 67432 13385655 NM_026152.1 0610010D20Rik NP_080428.1 ILMN_2735415 003190008 S 914 AAGAAAACCATGGACTGGTTTGGCTACTATGGAGGTCCCTGCCGCGCCCC 19 + 42144708-42144757 19qC3 Mus musculus RIKEN cDNA 0610010D20 gene (0610010D20Rik), mRNA. A semiautonomous, self replicating organelle that occurs in varying numbers, shapes, and sizes in the cytoplasm of virtually all eukaryotic cells. It is notably the site of tissue respiration [goid 5739] [evidence IDA] The chemical reactions and pathways, including anabolism and catabolism, by which living organisms transform chemical substances. Metabolic processes typically transform small molecules, but also include macromolecular processes such as DNA repair and replication, and protein synthesis and degradation [goid 8152] [evidence IEA] Catalysis of the cleavage of C-C, C-O, C-N and other bonds by other means than by hydrolysis or oxidation, or conversely adding a group to a double bond. They differ from other enzymes in that two substrates are involved in one reaction direction, but only one in the other direction. When acting on the single substrate, a molecule is eliminated and this generates either a new double bond or a new ring [goid 16829] [evidence IEA]; Catalysis of a biochemical reaction at physiological temperatures. In biologically catalyzed reactions, the reactants are known as substrates, and the catalysts are naturally occurring macromolecular substances known as enzymes. Enzymes possess specific binding sites for substrates, and are usually composed wholly or largely of protein, but RNA that has catalytic activity (ribozyme) is often also regarded as enzymatic [goid 3824] [evidence IEA] 0610010D24RIK 7510674 60.8 1 NaN 2.569 48 0.04487 54.0 1 NaN 1.904 56 0.08013 41.4 1 NaN 2.017 36 0.69231 40.8 1 NaN 1.433 48 0.70192 41.4 1 NaN 1.399 49 0.60791 35.8 1 NaN 1.399 46 0.87607 Mus musculus MEEBO ILMN_213099 ILMN_213099 0610010D24RIK scl068339.1_91 47087141 NM_026681 0610010D24Rik ILMN_1237980 007510674 S 971 GCCAGCATTTGAAGTAGGCTGTAGATGTCATTCGTTGCATTTAGAGGCCC 0610010E21RIK 3390088 1372.2 1 NaN 34.869 39 0.00000 382.8 1 NaN 12.486 36 0.00000 84.5 1 NaN 3.985 39 0.00000 80.6 1 NaN 3.615 33 0.00000 95.4 1 NaN 3.845 22 0.00000 62.5 1 NaN 3.563 42 0.00000 Mus musculus RefSeq ILMN_244634 ILMN_244634 0610010E21RIK NM_001033140.3 NM_001033140.3 68332 111118962 NM_001033140.3 0610010E21Rik NP_001028312.2 ILMN_2891688 003390088 S 773 CCCTGATGAACCGTGAGAAACTTGGCAGTCTGACTCGTTGTGAAGAACCG 7 - 31106572-31106621 7qB1 Mus musculus RIKEN cDNA 0610010E21 gene (0610010E21Rik), mRNA. AW490662; AI430885 0610010E21RIK 7160209 1078.7 1 NaN 62.973 43 0.00000 359.1 1 NaN 13.379 42 0.00000 85.6 1 NaN 3.060 46 0.00000 72.6 1 NaN 2.633 47 0.00000 88.1 1 NaN 4.152 39 0.00000 58.9 1 NaN 2.128 43 0.00214 Mus musculus RefSeq ILMN_192019 ILMN_244634 0610010E21RIK NM_001033140.3 NM_001033140.3 68332 111118962 NM_001033140.3 0610010E21Rik NP_001028312.2 ILMN_2484274 007160209 S 808 CGTTGTGAAGAACCGGGTTCATGAGGGAGATTACACTAGCTCATCTCAGC 7 - 31106537-31106586 7qB1 Mus musculus RIKEN cDNA 0610010E21 gene (0610010E21Rik), mRNA. AW490662; AI430885 0610010F05RIK 830088 43.6 1 NaN 1.982 67 0.81624 42.3 1 NaN 1.418 55 0.74038 41.3 1 NaN 1.542 50 0.70085 37.8 1 NaN 1.144 58 0.92628 41.4 1 NaN 1.308 69 0.60150 37.5 1 NaN 1.128 55 0.72970 Mus musculus RefSeq ILMN_192721 ILMN_238444 0610010F05RIK NM_027860.2 NM_027860.2 71675 117956374 NM_027860.2 0610010F05Rik NP_082136.2 ILMN_2490699 000830088 S 659 TGAAAACTGTACTGCTCGTAATGCTGGAGAAGAGACTGGAGAATCTGAAG 11 - 23522436-23522485 11qA3.2 Mus musculus RIKEN cDNA 0610010F05 gene (0610010F05Rik), mRNA. RP23-188K3.6; mKIAA1841 0610010F05RIK 3360209 444.5 1 NaN 17.926 41 0.00000 136.6 1 NaN 4.929 55 0.00000 51.0 1 NaN 2.128 38 0.05769 46.1 1 NaN 1.582 56 0.21154 48.6 1 NaN 1.890 54 0.08440 45.3 1 NaN 1.863 54 0.09615 Mus musculus MEEBO ILMN_217691 ILMN_217691 0610010F05RIK scl0071675.1_286 50233766 NM_027860 0610010F05Rik ILMN_2686463 003360209 S 4029 GATACATGGACAGGCATTTCTTCTGCCAAGTACGTTAAGGTTTTCCTTAC 0610010F05RIK 5290564 113.2 1 NaN 3.826 71 0.00000 79.0 1 NaN 2.891 63 0.00214 50.9 1 NaN 1.598 76 0.05876 51.4 1 NaN 1.908 50 0.03098 52.8 1 NaN 1.680 55 0.02885 48.5 1 NaN 1.760 53 0.02885 Mus musculus RefSeq ILMN_216372 ILMN_238444 0610010F05RIK NM_027860.2 NM_027860.2 71675 117956374 NM_027860.2 0610010F05Rik NP_082136.2 ILMN_2712923 005290564 S 1702 CGCCTTCTTGCCCACCTGCTAAAATACTGGATGATCTGCACAAGCACAAA 11 - 23495418-23495467 11qA3.2 Mus musculus RIKEN cDNA 0610010F05 gene (0610010F05Rik), mRNA. RP23-188K3.6; mKIAA1841 0610010F05RIK 7650470 203.9 1 NaN 6.871 34 0.00000 108.4 1 NaN 3.879 49 0.00000 47.7 1 NaN 1.959 44 0.14850 51.8 1 NaN 1.782 53 0.02778 49.1 1 NaN 2.198 45 0.06731 48.4 1 NaN 2.024 46 0.02991 Mus musculus MEEBO ILMN_216372 ILMN_216372 0610010F05RIK scl071675.1_1 XM_203572.3 38091312 XM_203572.3 0610010F05Rik ILMN_2670313 007650470 S 1609 CTAGGCTTGAAGCACAAGTCAGAGCCTCAGTACCTGTCACTGCCCGGCAG 0610010I05RIK 3990427 4635.3 1 NaN 184.725 50 0.00000 1080.4 1 NaN 42.592 58 0.00000 208.4 1 NaN 8.663 45 0.00000 204.6 1 NaN 6.683 51 0.00000 284.0 1 NaN 11.310 52 0.00000 168.9 1 NaN 6.830 48 0.00000 Mus musculus Riken ILMN_202718 ILMN_202718 0610010I05RIK ri|0610010I05|R000002G18|AK018737|135 AK018737 0610010I05Rik ILMN_2551741 003990427 S 82 AAACACATCAACTTCCCACTGTACACCACCACATCAATCAAATTCTCCTT 0610010K06RIK 1500400 1246.1 1 NaN 31.227 47 0.00000 431.0 1 NaN 12.968 33 0.00000 104.3 1 NaN 3.131 54 0.00000 95.9 1 NaN 5.517 26 0.00000 129.3 1 NaN 4.443 43 0.00000 72.9 1 NaN 2.918 35 0.00000 Mus musculus RefSeq ILMN_213500 ILMN_224439 0610010K06RIK NM_027861.2 NM_027861.2 71678 124244090 NM_027861.2 0610010K06Rik NP_082137.1 ILMN_2637698 001500400 S 3168 GGCCATGTTCACGTGATCGCATGAGCAGTCTTGTTGATTGTAAAGCTAAC 1|NT_165754.2 - 249928-249977 Mus musculus RIKEN cDNA 0610010K06 gene (0610010K06Rik), mRNA. Double layer of lipid molecules that encloses all cells, and, in eukaryotes, many organelles; may be a single or double lipid bilayer; also includes associated proteins [goid 16020] [evidence IEA] 0610010K06RIK 1570091 52.1 1 NaN 1.854 78 0.20513 47.9 1 NaN 1.335 62 0.24038 46.3 1 NaN 1.355 49 0.24038 47.0 1 NaN 1.633 59 0.16560 45.8 1 NaN 1.272 65 0.20727 40.0 1 NaN 1.323 44 0.48184 Mus musculus Riken ILMN_201958 ILMN_201958 0610010K06RIK ri|0610010K06|R000002I04|AK002489|817 AK002489 0610010K06Rik ILMN_1243274 001570091 S 499 GAAGGAAGGAAGCCGAGGACCACTGTGAGAGAACGTAGGCCTGATGCGTG Double layer of lipid molecules that encloses all cells, and, in eukaryotes, many organelles; may be a single or double lipid bilayer; also includes associated proteins [goid 16020] [evidence IEA] 0610010K14RIK 2690324 1215.4 1 NaN 36.904 41 0.00000 560.8 1 NaN 20.618 32 0.00000 79.8 1 NaN 2.705 37 0.00000 85.2 1 NaN 2.978 48 0.00000 87.3 1 NaN 2.867 48 0.00000 75.3 1 NaN 2.628 39 0.00000 Mus musculus RefSeq ILMN_216704 ILMN_216704 0610010K14RIK NM_026757.1 NM_026757.1 104457 21389317 NM_026757.1 0610010K14Rik NP_081033.1 ILMN_2674228 002690324 S 318 ATGACGTCCGGTGTCCTCTCACCTCCAAACGCCCCTCCACCCAGCAGCTC 11 - 70051096-70051106:70051033-70051071 11qB3 Mus musculus RIKEN cDNA 0610010K14 gene (0610010K14Rik), mRNA. A membrane-bounded organelle of eukaryotic cells in which chromosomes are housed and replicated. In most cells, the nucleus contains all of the cell's chromosomes except the organellar chromosomes, and is the site of RNA synthesis and processing. In some species, or in specialized cell types, RNA metabolism or DNA replication may be absent [goid 5634] [evidence IEA] Interacting selectively with DNA (deoxyribonucleic acid) [goid 3677] [evidence IEA] AL033328; RP23-198E14.7; AU045833; 1110020A23Rik 0610011B16RIK 5270551 51.1 1 NaN 2.852 55 0.24359 40.9 1 NaN 1.433 51 0.86218 37.8 1 NaN 1.582 45 0.93269 40.2 1 NaN 1.519 49 0.75748 39.2 1 NaN 1.903 32 0.82372 39.5 1 NaN 1.569 51 0.52244 Mus musculus RefSeq ILMN_207498 ILMN_207498 0610011B16RIK XM_148460.1 XM_148460.1 20891600 XM_148460.1 0610011B16Rik ILMN_1260494 005270551 I 1 AGGCAGGCCGCAGGAGCTTCCGATTGGTTGTCATCAATAAGGGCGTGGCA 0610011F06RIK 2230674 426.0 1 NaN 14.429 60 0.00000 197.1 1 NaN 7.459 51 0.00000 133.3 1 NaN 5.272 52 0.00000 118.6 1 NaN 3.298 56 0.00000 159.5 1 NaN 5.117 48 0.00000 108.2 1 NaN 4.750 49 0.00000 Mus musculus RefSeq ILMN_186795 ILMN_257036 0610011F06RIK NM_026686.1 NM_026686.1 68347 58037114 NM_026686.1 0610011F06Rik NP_080962.1 ILMN_2438555 002230674 S 239 TTGTCCAATGTGAAGGCTCCGCTGTACCTGGACGTGACCTGGGAGTGGGA 17 + 26012933-26012982 17qA3.3 Mus musculus RIKEN cDNA 0610011F06 gene (0610011F06Rik), mRNA. 0610011I19RIK 5910240 481.3 1 NaN 15.392 54 0.00000 194.5 1 NaN 5.938 47 0.00000 54.2 1 NaN 2.269 51 0.02350 51.0 1 NaN 1.722 50 0.03632 60.7 1 NaN 2.144 62 0.00321 47.9 1 NaN 1.933 44 0.03098 Mus musculus Riken ILMN_201956 ILMN_201956 0610011I19RIK ri|0610011I19|R000002D04|AK002548|1137 AK002548 0610011I19Rik ILMN_2545915 005910240 S 983 AGCAGTAGCAAGAACAGCATCCAAGCTAGCCACATCATCACCCGTGCCCC 0610011L14RIK 1710201 61.0 1 NaN 3.110 36 0.04487 50.3 1 NaN 2.246 47 0.15278 43.8 1 NaN 1.288 43 0.45299 44.3 1 NaN 2.400 27 0.36004 40.8 1 NaN 1.778 34 0.66132 42.5 1 NaN 1.793 31 0.24679 Mus musculus RefSeq ILMN_210035 ILMN_210035 0610011L14RIK NM_026661.3 NM_026661.3 68295 142365065 NM_026661.3 0610011L14Rik NP_080937.2 ILMN_2601546 001710201 S 3229 CATTCACTAACAGACTGTGTTGGGGTTAGGAGGCCACACGACATGCAGGC 2 + 156394513-156394562 2qH1 Mus musculus RIKEN cDNA 0610011L14 gene (0610011L14Rik), mRNA. Interacting selectively with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules) [goid 5515] [evidence IPI] 0610012A05RIK 6900731 51.5 1 NaN 2.216 34 0.22756 43.2 1 NaN 1.870 33 0.63462 40.3 1 NaN 2.120 38 0.79915 35.9 1 NaN 1.783 29 0.97543 38.5 1 NaN 1.856 32 0.86752 35.3 1 NaN 2.126 29 0.91346 Mus musculus MEEBO ILMN_189615 ILMN_189615 0610012A05RIK scl47331.6_185 21539602 NM_026153 0610012A05Rik ILMN_1230831 006900731 S 1 AAGGAAGTTATAGGTGAGAGGCTTGTGGAGAGGGGCTAACTCCAGTCCCC 0610012D14RIK 360544 70.8 1 NaN 3.354 36 0.00962 52.7 1 NaN 1.943 33 0.09722 39.9 1 NaN 2.016 30 0.83547 43.8 1 NaN 2.428 29 0.41239 43.8 1 NaN 1.912 39 0.36538 40.9 1 NaN 1.793 43 0.39637 Mus musculus RefSeq ILMN_213393 ILMN_213393 0610012D14RIK NM_026690.1 NM_026690.1 68352 21312001 NM_026690.1 0610012D14Rik NP_080966.1 ILMN_2848071 000360544 S 652 CCCCAGTCTAGGCTTCGACCGTGTCATTGGGGTGCTTGTGGCTGACCTTA 7 + 51722425-51722474 7qB4 Mus musculus RIKEN cDNA 0610012D14 gene (0610012D14Rik), mRNA. The process of removal or addition of one or more electrons with or without the concomitant removal or addition of a proton or protons [goid 55114] [evidence IEA]; The chemical reactions and pathways resulting in the formation of a pyridine nucleotide, a nucleotide characterized by a pyridine derivative as a nitrogen base [goid 19363] [evidence IEA]; The chemical reactions and pathways, including anabolism and catabolism, by which living organisms transform chemical substances. Metabolic processes typically transform small molecules, but also include macromolecular processes such as DNA repair and replication, and protein synthesis and degradation [goid 8152] [evidence IEA]; The chemical reactions and pathways resulting in the breakdown of nicotinamide-adenine dinucleotide phosphate, a coenzyme involved in many redox and biosynthetic reactions; catabolism may be of either the oxidized form, NADP, or the reduced form, NADPH [goid 6742] [evidence IEA] Catalysis of an oxidation-reduction (redox) reaction, a reversible chemical reaction in which the oxidation state of an atom or atoms within a molecule is altered. One substrate acts as a hydrogen or electron donor and becomes oxidized, while the other acts as hydrogen or electron acceptor and becomes reduced [goid 16491] [evidence IEA]; Catalysis of the reaction: L-aspartate + H2O + NAD(P)+ = oxaloacetate + NH3 + NAD(P)H + H+ [goid 33735] [evidence IEA]; Catalysis of a biochemical reaction at physiological temperatures. In biologically catalyzed reactions, the reactants are known as substrates, and the catalysts are naturally occurring macromolecular substances known as enzymes. Enzymes possess specific binding sites for substrates, and are usually composed wholly or largely of protein, but RNA that has catalytic activity (ribozyme) is often also regarded as enzymatic [goid 3824] [evidence IEA]; The selective, often stoichiometric, interaction of a molecule with one or more specific sites on another molecule [goid 5488] [evidence IEA] 0610012D14RIK 3190202 78.2 1 NaN 3.186 36 0.00534 60.0 1 NaN 1.875 45 0.03098 41.1 1 NaN 1.806 42 0.72436 41.6 1 NaN 1.650 40 0.61859 38.1 1 NaN 1.512 42 0.88462 39.5 1 NaN 1.673 52 0.52244 Mus musculus RefSeq ILMN_213393 ILMN_213393 0610012D14RIK NM_026690.1 NM_026690.1 68352 21312001 NM_026690.1 0610012D14Rik NP_080966.1 ILMN_1248518 003190202 S 896 TGCTGAGTCTCCTCCCCTACTACCCTTACTGTCATATTGACAACTATGGG 7 + 51723051-51723056:51723057-51723100 7qB4 Mus musculus RIKEN cDNA 0610012D14 gene (0610012D14Rik), mRNA. The process of removal or addition of one or more electrons with or without the concomitant removal or addition of a proton or protons [goid 55114] [evidence IEA]; The chemical reactions and pathways resulting in the formation of a pyridine nucleotide, a nucleotide characterized by a pyridine derivative as a nitrogen base [goid 19363] [evidence IEA]; The chemical reactions and pathways, including anabolism and catabolism, by which living organisms transform chemical substances. Metabolic processes typically transform small molecules, but also include macromolecular processes such as DNA repair and replication, and protein synthesis and degradation [goid 8152] [evidence IEA]; The chemical reactions and pathways resulting in the breakdown of nicotinamide-adenine dinucleotide phosphate, a coenzyme involved in many redox and biosynthetic reactions; catabolism may be of either the oxidized form, NADP, or the reduced form, NADPH [goid 6742] [evidence IEA] Catalysis of an oxidation-reduction (redox) reaction, a reversible chemical reaction in which the oxidation state of an atom or atoms within a molecule is altered. One substrate acts as a hydrogen or electron donor and becomes oxidized, while the other acts as hydrogen or electron acceptor and becomes reduced [goid 16491] [evidence IEA]; Catalysis of the reaction: L-aspartate + H2O + NAD(P)+ = oxaloacetate + NH3 + NAD(P)H + H+ [goid 33735] [evidence IEA]; Catalysis of a biochemical reaction at physiological temperatures. In biologically catalyzed reactions, the reactants are known as substrates, and the catalysts are naturally occurring macromolecular substances known as enzymes. Enzymes possess specific binding sites for substrates, and are usually composed wholly or largely of protein, but RNA that has catalytic activity (ribozyme) is often also regarded as enzymatic [goid 3824] [evidence IEA]; The selective, often stoichiometric, interaction of a molecule with one or more specific sites on another molecule [goid 5488] [evidence IEA] 0610012G03RIK 5700132 2632.8 1 NaN 90.765 60 0.00000 1227.2 1 NaN 42.763 32 0.00000 338.4 1 NaN 13.958 33 0.00000 299.4 1 NaN 11.621 41 0.00000 413.0 1 NaN 17.874 36 0.00000 276.8 1 NaN 13.333 34 0.00000 Mus musculus MEEBO ILMN_215367 ILMN_215367 0610012G03RIK scl48561.1.13_8 13384687 NM_025320 0610012G03Rik ILMN_2658619 005700132 S 636 ACTGGTGCAGGAGAATACCAGGGGAGCTTGTAAATGGAACGACAACCCCG The part of a cell or its extracellular environment in which a gene product is located. A gene product may be located in one or more parts of a cell and its location may be as specific as a particular macromolecular complex, that is, a stable, persistent association of macromolecules that function together [goid 5575] [evidence ND ] Any process specifically pertinent to the functioning of integrated living units: cells, tissues, organs, and organisms. A process is a collection of molecular events with a defined beginning and end [goid 8150] [evidence ND ] Interacting selectively with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules) [goid 5515] [evidence IPI] 0610012H03RIK 3460754 49.2 1 NaN 2.116 35 0.34509 39.2 1 NaN 1.614 37 0.94017 39.0 1 NaN 1.406 36 0.88782 40.9 1 NaN 1.893 42 0.69658 38.6 1 NaN 1.353 40 0.86752 39.7 1 NaN 1.752 33 0.50214 Mus musculus RefSeq ILMN_217412 ILMN_217412 0610012H03RIK NM_028747.1 NM_028747.1 74088 21311852 NM_028747.1 0610012H03Rik NP_083023.1 ILMN_2682917 003460754 S 1002 ACCCCTTTAAGAGAAGTGCACAGTGAGGTTTACAGACAGAAGCCATTCAC 2 + 105219423-105219472 2qE3 Mus musculus RIKEN cDNA 0610012H03 gene (0610012H03Rik), mRNA. A semiautonomous, self replicating organelle that occurs in varying numbers, shapes, and sizes in the cytoplasm of virtually all eukaryotic cells. It is notably the site of tissue respiration [goid 5739] [evidence IDA] Any process specifically pertinent to the functioning of integrated living units: cells, tissues, organs, and organisms. A process is a collection of molecular events with a defined beginning and end [goid 8150] [evidence ND ] Elemental activities, such as catalysis or binding, describing the actions of a gene product at the molecular level. A given gene product may exhibit one or more molecular functions [goid 3674] [evidence ND ] RP23-444H3.1 0610012H03RIK 4260014 113.0 1 NaN 4.806 39 0.00000 61.1 1 NaN 2.458 36 0.02991 46.1 1 NaN 1.489 43 0.25214 41.4 1 NaN 1.843 35 0.64423 40.5 1 NaN 2.111 31 0.70620 43.3 1 NaN 2.440 30 0.19017 Mus musculus RefSeq ILMN_217412 ILMN_217412 0610012H03RIK NM_028747.1 NM_028747.1 74088 21311852 NM_028747.1 0610012H03Rik NP_083023.1 ILMN_2972403 004260014 S 1438 GCTTCTCTGCCACATCCTTAGCCTATATTCATTACCTGTGTCATGGGTGG 2 + 105219859-105219908 2qE3 Mus musculus RIKEN cDNA 0610012H03 gene (0610012H03Rik), mRNA. A semiautonomous, self replicating organelle that occurs in varying numbers, shapes, and sizes in the cytoplasm of virtually all eukaryotic cells. It is notably the site of tissue respiration [goid 5739] [evidence IDA] Any process specifically pertinent to the functioning of integrated living units: cells, tissues, organs, and organisms. A process is a collection of molecular events with a defined beginning and end [goid 8150] [evidence ND ] Elemental activities, such as catalysis or binding, describing the actions of a gene product at the molecular level. A given gene product may exhibit one or more molecular functions [goid 3674] [evidence ND ] RP23-444H3.1 0610013E23RIK 5900646 54.0 1 NaN 3.240 24 0.13782 50.2 1 NaN 3.620 30 0.15491 36.1 1 NaN 1.221 41 0.97329 37.7 1 NaN 1.861 25 0.93162 41.0 1 NaN 1.617 33 0.64209 32.3 1 NaN 1.378 34 0.98611 Mus musculus RefSeq ILMN_214153 ILMN_214153 0610013E23RIK NM_029788.2 NM_029788.2 76892 31541789 NM_029788.2 0610013E23Rik NP_084064.1 ILMN_2973337 005900646 S 3831 TGAGGACTGGGAAGGGACTGAAGGCAGGCACCACCGCATGTGGCAAGATG 11 + 86314599-86314648 11qC Mus musculus RIKEN cDNA 0610013E23 gene (0610013E23Rik), mRNA. AV007605; RP23-467J12.1 0610025G21RIK 430280 50.7 1 NaN 2.344 53 0.25748 45.0 1 NaN 1.824 41 0.48718 40.3 1 NaN 1.325 51 0.81090 41.8 1 NaN 1.388 60 0.59509 39.4 1 NaN 1.358 50 0.80449 38.2 1 NaN 1.525 50 0.66346 Mus musculus Riken ILMN_202405 ILMN_202405 0610025G21RIK ri|0610025G21|R000004G05|AK002660|561 AK002660 0610025G21Rik ILMN_2549368 000430280 S 245 TCTCAGATTAAAGGAGCCAGCCAGGACCGTGCAGAAGTACTCCCGAGGGG 0610025J13RIK 1980110 51.0 1 NaN 1.888 62 0.24573 43.9 1 NaN 1.666 58 0.58654 43.7 1 NaN 1.478 74 0.46795 47.3 1 NaN 1.913 48 0.14637 40.6 1 NaN 1.590 60 0.69444 41.0 1 NaN 1.389 68 0.38675 Mus musculus MEEBO ILMN_184441 ILMN_184441 0610025J13RIK scl25258.6.1_0 51709792 XM_355548 0610025J13Rik ILMN_2418656 001980110 S 16 CGCCACCTACCGGCGACCAGGCAAGCGTCAGTGCGACCCCAAAGCAAGCT 0610025J13RIK 4890184 52.7 1 NaN 2.133 58 0.17521 48.5 1 NaN 2.050 50 0.21368 49.8 1 NaN 2.080 43 0.07479 42.7 1 NaN 1.378 49 0.50214 44.0 1 NaN 1.567 47 0.34936 41.5 1 NaN 1.486 57 0.34615 Mus musculus MEEBO ILMN_184441 ILMN_184441 0610025J13RIK scl25258.6.1_0 51709792 XM_355548 0610025J13Rik ILMN_1236032 004890184 S 19 CACCTACCGGCGACCAGGCAAGCGTCAGTGCGACCCCAAAGCAAGCTGCT 0610025P10RIK 6270482 250.9 1 NaN 7.084 39 0.00000 154.9 1 NaN 5.116 28 0.00000 58.4 1 NaN 2.067 37 0.00534 61.0 1 NaN 1.951 42 0.00214 60.9 1 NaN 2.268 37 0.00321 54.4 1 NaN 2.466 34 0.00427 Mus musculus RefSeq ILMN_211309 ILMN_235057 0610025P10RIK NM_001013414.1 NM_001013414.1 216860 61740636 NM_001013414.1 0610025P10Rik NP_001013432.1 ILMN_1226653 006270482 S 4935 GCACTGACTTGGGGAACATGACTCCCTATTATTACCCTCCCCCATATCAC 11 + 69721413-69721462 11qB3 Mus musculus RIKEN cDNA 0610025P10 gene (0610025P10Rik), mRNA. BC023037; RP23-172M21.17; KIAA1787 0610030E20RIK 2100092 160.7 1 NaN 6.321 55 0.00000 100.0 1 NaN 4.764 55 0.00000 49.8 1 NaN 1.513 49 0.07479 48.4 1 NaN 2.440 47 0.10256 53.3 1 NaN 1.841 43 0.02564 41.7 1 NaN 1.355 58 0.33013 Mus musculus RefSeq ILMN_208862 ILMN_231632 0610030E20RIK XM_910556.2 XM_910556.2 68364 94377644 XM_910556.2 0610030E20Rik XP_915649.1 ILMN_2655105 002100092 S 1190 TGAGGTCGTTTGTCAGGCCCCTTCATGTTTCTGCTTTCTTCCACTCATCT 6qC1 PREDICTED: Mus musculus RIKEN cDNA 0610030E20 gene, transcript variant 6 (0610030E20Rik), mRNA. 0610030E20RIK 2190551 125.5 1 NaN 4.401 51 0.00000 84.4 1 NaN 2.192 49 0.00000 46.8 1 NaN 1.888 56 0.20833 42.1 1 NaN 1.575 66 0.57051 40.2 1 NaN 1.667 37 0.73184 37.8 1 NaN 1.791 39 0.70299 Mus musculus RefSeq ILMN_201793 ILMN_231920 0610030E20RIK XM_921694.2 XM_921694.2 68364 94377646 XM_921694.2 0610030E20Rik XP_926787.1 ILMN_2544634 002190551 S 839 TAAGGTAGCTGGGACCCGGCCAGGAAACGCTGTCCACCAGTGTGATCTAT 6qC1 PREDICTED: Mus musculus RIKEN cDNA 0610030E20 gene, transcript variant 9 (0610030E20Rik), mRNA. 0610030E20RIK 6280719 49.9 1 NaN 2.729 42 0.29915 46.5 1 NaN 1.748 49 0.33547 41.2 1 NaN 1.354 62 0.71047 39.7 1 NaN 1.542 48 0.78846 44.5 1 NaN 1.989 42 0.30342 42.6 1 NaN 1.701 43 0.23932 Mus musculus RefSeq ILMN_208862 ILMN_231632 0610030E20RIK XM_910556.2 XM_910556.2 68364 94377644 XM_910556.2 0610030E20Rik XP_915649.1 ILMN_2653890 006280719 S 2893 GGTCGGGACAAAGAACATTGGAACTTTTTGGGGGTCTGTGTTCTTAGAGC 6qC1 PREDICTED: Mus musculus RIKEN cDNA 0610030E20 gene, transcript variant 6 (0610030E20Rik), mRNA. 0610030E20RIK 6510338 551.7 1 NaN 18.521 46 0.00000 200.3 1 NaN 7.718 30 0.00000 49.2 1 NaN 1.969 44 0.08868 43.7 1 NaN 2.074 40 0.41667 55.6 1 NaN 2.180 49 0.01389 46.6 1 NaN 2.132 48 0.05876 Mus musculus RefSeq ILMN_208862 ILMN_231632 0610030E20RIK XM_910556.2 XM_910556.2 68364 94377644 XM_910556.2 0610030E20Rik XP_915649.1 ILMN_1220374 006510338 S 4598 CCTAGTTAGGGGTTCCTCCTTTCCCAGAGCAAACAGAACAAGAGGTTGGG 6qC1 PREDICTED: Mus musculus RIKEN cDNA 0610030E20 gene, transcript variant 6 (0610030E20Rik), mRNA. 0610030G03RIK 1340356 62.3 1 NaN 3.706 46 0.03846 50.1 1 NaN 2.848 42 0.15919 36.5 1 NaN 1.495 47 0.96688 40.3 1 NaN 2.117 44 0.74786 39.5 1 NaN 1.932 38 0.79915 38.3 1 NaN 1.689 37 0.65064 Mus musculus Riken ILMN_201610 ILMN_201610 0610030G03RIK ri|0610030G03|R000004K23|AK002703|711 AK002703 0610030G03Rik ILMN_1253221 001340356 S 510 TGGAGCCAGGGAGGGAGGCCATCTTAACCCAGCAGCGTCTGACTTCTAAG 0610030P10RIK 5260669 218.0 1 NaN 8.514 53 0.00000 100.4 1 NaN 3.501 55 0.00000 41.1 1 NaN 1.295 53 0.72329 41.4 1 NaN 1.614 48 0.64316 40.6 1 NaN 1.677 49 0.68376 39.1 1 NaN 1.531 47 0.56410 Mus musculus Riken ILMN_201612 ILMN_201612 0610030P10RIK ri|0610030P10|R000004M19|AK002715|815 AK002715 0610030P10Rik ILMN_2543198 005260669 S 631 CAAGGAGGATCGATGTTACAGAGATAAGATCCAGAGTGCCCGCTGCCTGG 0610031G08RIK 2070347 99.6 1 NaN 3.774 55 0.00000 65.3 1 NaN 3.086 38 0.01282 90.4 1 NaN 4.408 44 0.00000 104.7 1 NaN 3.277 49 0.00000 129.5 1 NaN 4.373 60 0.00000 93.4 1 NaN 3.507 59 0.00000 Mus musculus MEEBO ILMN_187514 ILMN_187514 0610031G08RIK scl075393.1_11 0610031G08Rik ILMN_2444799 002070347 S 19 GGAAGACCAGAGAGTTGCCTCGACGTTGTTCACCTAAATCCGTGGCGGGC 0610031J06RIK 540041 192.6 1 NaN 10.634 24 0.00000 104.2 1 NaN 6.747 21 0.00000 54.8 1 NaN 2.939 30 0.01816 49.7 1 NaN 2.689 32 0.06197 50.0 1 NaN 1.720 40 0.04915 41.3 1 NaN 2.045 38 0.36004 Mus musculus RefSeq ILMN_212580 ILMN_212580 0610031J06RIK NM_020003.1 NM_020003.1 56700 9910457 NM_020003.1 0610031J06Rik NP_064387.1 ILMN_2727437 000540041 S 1031 GAACAACTTCTGTGCCTTCAATCTGACCTTTGGGGCTCCCACGGGCCCTG 3 + 88131958-88132007 3qF1 Mus musculus RIKEN cDNA 0610031J06 gene (0610031J06Rik), mRNA. Penetrating at least one phospholipid bilayer of a membrane. May also refer to the state of being buried in the bilayer with no exposure outside the bilayer. When used to describe a protein, indicates that all or part of the peptide sequence is embedded in the membrane [goid 16021] [evidence IEA]; Double layer of lipid molecules that encloses all cells, and, in eukaryotes, many organelles; may be a single or double lipid bilayer; also includes associated proteins [goid 16020] [evidence IEA] AB027141; NCU-G1 0610031J06RIK 3800215 824.8 1 NaN 21.932 37 0.00000 490.9 1 NaN 14.708 49 0.00000 109.8 1 NaN 4.860 48 0.00000 93.1 1 NaN 3.456 45 0.00000 115.7 1 NaN 3.749 45 0.00000 86.4 1 NaN 2.641 44 0.00000 Mus musculus RefSeq ILMN_212580 ILMN_212580 0610031J06RIK NM_020003.1 NM_020003.1 56700 9910457 NM_020003.1 0610031J06Rik NP_064387.1 ILMN_2628021 003800215 S 1350 CTGCAGAACCTCAGAAGCCAGCCTCAACCTACTGGGGTGCTCCCAGTAAG 3 + 88132366-88132415 3qF1 Mus musculus RIKEN cDNA 0610031J06 gene (0610031J06Rik), mRNA. Penetrating at least one phospholipid bilayer of a membrane. May also refer to the state of being buried in the bilayer with no exposure outside the bilayer. When used to describe a protein, indicates that all or part of the peptide sequence is embedded in the membrane [goid 16021] [evidence IEA]; Double layer of lipid molecules that encloses all cells, and, in eukaryotes, many organelles; may be a single or double lipid bilayer; also includes associated proteins [goid 16020] [evidence IEA] AB027141; NCU-G1 0610031J06RIK 5810243 655.1 1 NaN 22.991 54 0.00000 310.7 1 NaN 10.261 38 0.00000 81.6 1 NaN 3.286 43 0.00000 76.4 1 NaN 3.191 40 0.00000 102.6 1 NaN 4.306 34 0.00000 69.9 1 NaN 2.625 40 0.00000 Mus musculus RefSeq ILMN_212580 ILMN_212580 0610031J06RIK NM_020003.1 NM_020003.1 56700 9910457 NM_020003.1 0610031J06Rik NP_064387.1 ILMN_2793281 005810243 S 1259 CCAGTCCATAAACTGAAACCCACTCTCCAGAGGGAAGGGCAGTGTCTCAG 3 + 88132275-88132290:88132291-88132324 3qF1 Mus musculus RIKEN cDNA 0610031J06 gene (0610031J06Rik), mRNA. Penetrating at least one phospholipid bilayer of a membrane. May also refer to the state of being buried in the bilayer with no exposure outside the bilayer. When used to describe a protein, indicates that all or part of the peptide sequence is embedded in the membrane [goid 16021] [evidence IEA]; Double layer of lipid molecules that encloses all cells, and, in eukaryotes, many organelles; may be a single or double lipid bilayer; also includes associated proteins [goid 16020] [evidence IEA] AB027141; NCU-G1 0610033M06RIK 3400750 49.2 1 NaN 3.522 41 0.35150 37.1 1 NaN 1.751 49 0.98504 37.7 1 NaN 1.860 41 0.93697 37.4 1 NaN 1.432 33 0.94017 36.4 1 NaN 1.520 41 0.95940 31.8 1 NaN 1.205 56 0.99038 Mus musculus Riken ILMN_207261 ILMN_207261 0610033M06RIK ri|G630005K04|PL00012N06|AK090146|2714 AK090146 0610033M06Rik ILMN_1253176 003400750 S 2530 AAGAGTTGTAATCGGCAGGGAGGCAGTGGGAAGGGCAGAAGGGACTGAGG 0610035N01RIK 6060528 51.3 1 NaN 2.139 42 0.23611 41.6 1 NaN 1.742 50 0.80128 42.3 1 NaN 1.781 43 0.60150 42.2 1 NaN 2.034 47 0.55235 37.3 1 NaN 1.519 42 0.92308 36.1 1 NaN 1.336 38 0.85043 Mus musculus Riken ILMN_203527 ILMN_203527 0610035N01RIK ri|5330402M06|PX00053E21|AK030365|4168 AK030365 0610035N01Rik ILMN_1228112 006060528 S 3984 TGGTCCATCGGGAGCCATGAAGTTGGTTACTGGCCTGGGGTTCTTCTCTG 0610037B23RIK 1980367 50.3 1 NaN 1.719 86 0.26923 52.2 1 NaN 1.542 66 0.10791 45.0 1 NaN 1.734 55 0.33333 45.7 1 NaN 1.538 62 0.24359 45.2 1 NaN 1.363 54 0.25321 43.5 1 NaN 1.529 52 0.17415 Mus musculus Riken ILMN_201604 ILMN_201604 0610037B23RIK ri|0610037B23|R000004B17|AK002767|743 AK002767 0610037B23Rik ILMN_1248172 001980367 S 546 CTCTGGTCAACTCTGCTCGCTCAGTACCTGCTCACTCTGGCCCAAGGATT 0610037D15RIK 5270753 190.7 1 NaN 8.409 39 0.00000 101.5 1 NaN 4.737 41 0.00000 48.8 1 NaN 1.873 46 0.10256 44.7 1 NaN 1.365 37 0.33227 48.4 1 NaN 2.074 46 0.09081 47.2 1 NaN 1.738 50 0.04487 Mus musculus RefSeq ILMN_216272 ILMN_216272 0610037D15RIK NM_026714.2 NM_026714.2 68394 134053899 NM_026714.2 0610037D15Rik NP_080990.2 ILMN_1234456 005270753 S 813 GGACAGGGTTCATACCTTGGAGGTTTCCAGTACAGAGGCCCATGATGCCC 4 + 116385357-116385406 4qD1 Mus musculus RIKEN cDNA 0610037D15 gene (0610037D15Rik), mRNA. 4933430J04Rik 0610037L13RIK 2070564 1070.0 1 NaN 32.493 38 0.00000 594.0 1 NaN 25.894 25 0.00000 167.7 1 NaN 3.918 37 0.00000 159.8 1 NaN 5.892 38 0.00000 199.8 1 NaN 8.123 33 0.00000 125.9 1 NaN 3.553 46 0.00000 Mus musculus RefSeq ILMN_210991 ILMN_210991 0610037L13RIK NM_028754.2 NM_028754.2 74098 118130504 NM_028754.2 0610037L13Rik NP_083030.1 ILMN_2611352 002070564 S 1457 GTTGTGCCTTCATACCTGGGAAACCTGTTTCCACACACTATTTCTCCAAT 4 + 107570313-107570362 4qC7 Mus musculus RIKEN cDNA 0610037L13 gene (0610037L13Rik), mRNA. The part of a cell or its extracellular environment in which a gene product is located. A gene product may be located in one or more parts of a cell and its location may be as specific as a particular macromolecular complex, that is, a stable, persistent association of macromolecules that function together [goid 5575] [evidence ND ] Any process specifically pertinent to the functioning of integrated living units: cells, tissues, organs, and organisms. A process is a collection of molecular events with a defined beginning and end [goid 8150] [evidence ND ] Elemental activities, such as catalysis or binding, describing the actions of a gene product at the molecular level. A given gene product may exhibit one or more molecular functions [goid 3674] [evidence ND ] 1110008H16Rik; RP23-40G2.3 0610037L13RIK 3840519 634.6 1 NaN 33.437 30 0.00000 298.8 1 NaN 9.828 41 0.00000 96.6 1 NaN 4.014 43 0.00000 89.4 1 NaN 3.318 44 0.00000 127.0 1 NaN 6.274 31 0.00000 98.4 1 NaN 4.336 37 0.00000 Mus musculus MEEBO ILMN_210991 ILMN_210991 0610037L13RIK scl074098.7_10 NM_028754.1 21539638 NM_028754.1 0610037L13Rik ILMN_2622630 003840519 S 221 AAATCGCACTGCAGCTCAAAGCCACGCTGGAGAACGTCACGAACCTTCGG The part of a cell or its extracellular environment in which a gene product is located. A gene product may be located in one or more parts of a cell and its location may be as specific as a particular macromolecular complex, that is, a stable, persistent association of macromolecules that function together [goid 5575] [evidence ND ] Any process specifically pertinent to the functioning of integrated living units: cells, tissues, organs, and organisms. A process is a collection of molecular events with a defined beginning and end [goid 8150] [evidence ND ] Elemental activities, such as catalysis or binding, describing the actions of a gene product at the molecular level. A given gene product may exhibit one or more molecular functions [goid 3674] [evidence ND ] 0610037M15RIK 5820128 132.3 1 NaN 4.676 62 0.00000 72.2 1 NaN 3.492 53 0.00321 51.3 1 NaN 1.656 57 0.05021 49.4 1 NaN 1.371 64 0.07585 50.6 1 NaN 1.713 38 0.04274 43.4 1 NaN 1.459 72 0.18483 Mus musculus MEEBO ILMN_193252 ILMN_193252 0610037M15RIK scl0068395.1_77 0610037M15Rik ILMN_2495446 005820128 S 5 GACCGCACAGAGATACTACAACCAGAGCAAGGGCGGCTCTCACACACTCC 0610037P05RIK 6480132 70.5 1 NaN 4.457 41 0.00962 49.2 1 NaN 2.231 54 0.18483 44.3 1 NaN 1.402 58 0.39316 42.7 1 NaN 1.223 54 0.50962 40.2 1 NaN 1.530 46 0.73184 36.7 1 NaN 1.308 59 0.81090 Mus musculus RefSeq ILMN_211262 ILMN_227024 0610037P05RIK NM_025345.2 NM_025345.2 66086 31560259 NM_025345.2 0610037P05Rik NP_079621.1 ILMN_1230077 006480132 S 258 CCATTGGACAGACAGTTTCTCATCCGTGAACTAAATGCCTTTGAAGAATC 16 - 14311154-14311203 16qA1 Mus musculus RIKEN cDNA 0610037P05 gene (0610037P05Rik), mRNA. 0610037P05RIK 6860170 42.5 1 NaN 2.165 30 0.86432 40.6 1 NaN 1.527 42 0.87073 41.0 1 NaN 2.138 27 0.74145 41.2 1 NaN 1.775 33 0.66774 40.7 1 NaN 1.661 40 0.67735 33.6 1 NaN 1.248 27 0.97329 Mus musculus RefSeq ILMN_211262 ILMN_227024 0610037P05RIK NM_025345.2 NM_025345.2 66086 31560259 NM_025345.2 0610037P05Rik NP_079621.1 ILMN_2717539 006860170 S 999 TTGAAAAAATATCTAAAGGAATATTAAAACCAGAACTTAATTTATATGAA 16 - 14299710-14299759 16qA1 Mus musculus RIKEN cDNA 0610037P05 gene (0610037P05Rik), mRNA. 0610038B21RIK 3130332 73.0 1 NaN 2.087 54 0.00748 48.6 1 NaN 1.782 49 0.20940 39.4 1 NaN 1.146 52 0.87500 37.0 1 NaN 1.469 54 0.94872 41.4 1 NaN 1.262 59 0.60363 35.8 1 NaN 1.012 56 0.87393 Mus musculus MEEBO ILMN_186207 ILMN_186207 0610038B21RIK scl070345.3_145 0610038B21Rik ILMN_1246762 003130332 S 7 CATTTTATCTGTGTACCGAAGGAAGGGTGCTTCGCTGTGCAAGGGCTCGC 0610038D11RIK 6760408 149.0 1 NaN 4.733 58 0.00000 99.3 1 NaN 3.298 50 0.00000 54.0 1 NaN 1.886 62 0.02350 52.3 1 NaN 1.487 54 0.02671 52.7 1 NaN 1.869 56 0.02885 49.4 1 NaN 1.658 57 0.02137 Mus musculus RefSeq ILMN_190490 ILMN_233182 0610038D11RIK NM_026306.2 NM_026306.2 67674 61098119 NM_026306.2 0610038D11Rik NP_080582.2 ILMN_2470615 006760408 S 237 TCCGATCTCGGCTGCCGCCAAGCCCCCCAAAAGGTCCCCTAAGTCGGCCA 19 + 6984522-6984571 19qA Mus musculus RIKEN cDNA 0610038D11 gene (0610038D11Rik), mRNA. 0610038F07RIK 3990307 464.4 1 NaN 13.730 51 0.00000 199.1 1 NaN 7.144 50 0.00000 74.9 1 NaN 2.334 48 0.00000 78.3 1 NaN 2.919 51 0.00000 88.3 1 NaN 2.166 53 0.00000 63.4 1 NaN 2.196 43 0.00000 Mus musculus RefSeq ILMN_209464 ILMN_209464 0610038F07RIK NM_025333.3 NM_025333.3 66072 53828928 NM_025333.3 0610038F07Rik NP_079609.2 ILMN_2596016 003990307 S 1672 CGCTCCCACAGACAAATAGCATTGGGCCTACTTAAGGACAAGAGATTGCC 19 - 10576377-10576426 19qA Mus musculus RIKEN cDNA 0610038F07 gene (0610038F07Rik), mRNA. A semiautonomous, self replicating organelle that occurs in varying numbers, shapes, and sizes in the cytoplasm of virtually all eukaryotic cells. It is notably the site of tissue respiration [goid 5739] [evidence IEA] Any process specifically pertinent to the functioning of integrated living units: cells, tissues, organs, and organisms. A process is a collection of molecular events with a defined beginning and end [goid 8150] [evidence ND ] Elemental activities, such as catalysis or binding, describing the actions of a gene product at the molecular level. A given gene product may exhibit one or more molecular functions [goid 3674] [evidence ND ] AA407634; AW049997; MGC61338 0610038F15RIK 4250086 54.7 1 NaN 2.096 50 0.11325 49.6 1 NaN 1.983 42 0.17628 49.6 1 NaN 1.327 60 0.07906 47.6 1 NaN 2.043 40 0.13248 43.9 1 NaN 1.239 64 0.35684 43.7 1 NaN 1.753 51 0.16453 Mus musculus Riken ILMN_201606 ILMN_201606 0610038F15RIK ri|0610038F15|R000004H07|AK002794|638 AK002794 0610038F15Rik ILMN_2543157 004250086 S 343 TGAGGACACTTTGCAGGAGACGGAGATTTAGATAACCCGTGTGGGTGCCC 0610039K10RIK 5340379 48.1 1 NaN 1.909 62 0.42521 40.6 1 NaN 1.527 56 0.87393 39.6 1 NaN 1.228 73 0.86004 36.6 1 NaN 1.133 54 0.96154 37.2 1 NaN 1.289 62 0.93056 36.2 1 NaN 1.236 65 0.84081 Mus musculus MEEBO ILMN_186331 ILMN_186331 0610039K10RIK scl19955.1.2_15 0610039K10Rik ILMN_2434621 005340379 S 2 GAGAGATGGAATGTTGGCAAACTCAGAGGCAAACAGGCTATGTTGGGCCA 0610040B10RIK 7330743 133.5 1 NaN 5.118 42 0.00000 82.7 1 NaN 3.128 43 0.00000 47.3 1 NaN 2.230 43 0.16774 39.4 1 NaN 1.355 31 0.80556 50.6 1 NaN 2.124 40 0.04380 41.4 1 NaN 1.287 32 0.35897 Mus musculus RefSeq ILMN_215673 ILMN_319139 0610040B10RIK XM_001479510.1 XM_001479510.1 67672 149254466 XM_001479510.1 0610040B10Rik XP_001479560.1 ILMN_1242334 007330743 S 502 CCATGATCCCTTGTCCCTGGGAGGACTGTCTGAGACATTAGAGAAATGGG PREDICTED: Mus musculus RIKEN cDNA 0610040B10 gene (0610040B10Rik), mRNA. 0610040J01RIK 4920632 83.1 1 NaN 2.980 44 0.00107 66.2 1 NaN 2.989 36 0.01068 40.3 1 NaN 1.555 41 0.81197 42.0 1 NaN 1.578 53 0.57265 42.1 1 NaN 1.965 24 0.52671 41.0 1 NaN 1.799 29 0.39316 Mus musculus RefSeq ILMN_209810 ILMN_209810 0610040J01RIK NM_029554.2 NM_029554.2 76261 31981328 NM_029554.2 0610040J01Rik NP_083830.2 ILMN_2915716 004920632 S 1564 GCCCGGACATCCCCACTCTTGATCCCAGGGGCCATTCTGTTTGAATGTAT 5 + 64178317-64178366 5qC3.1 Mus musculus RIKEN cDNA 0610040J01 gene (0610040J01Rik), mRNA. AI662686 0610040O15RIK 940634 32153.0 1 NaN 638.670 39 0.00000 18665.4 1 NaN 488.091 45 0.00000 4204.8 1 NaN 113.866 59 0.00000 4115.0 1 NaN 118.560 47 0.00000 5468.4 1 NaN 122.922 44 0.00000 2763.2 1 NaN 69.494 58 0.00000 Mus musculus Riken ILMN_202712 ILMN_202712 0610040O15RIK ri|0610040O15|R000004D20|AK018753|84 AK018753 0610040O15Rik ILMN_1240829 000940634 S 1 GTAGAATACGCAGCCGGCCCATTCGCGTTATTCTTTATAGCAGAGTACAC