Illumina mapping nuId to genome coordinates. >m2<- read.table("processed_data.csv", header=T, row.names=1, sep="\t") >probes<- rownames(m2) >dd<- probeID2nuID(probes) >seqs<- id2seq(dd[,7]) >test<- cbind(dd, seqs) > test[grep("r33p5EJWUK57ZWL3no", test[,7]),] Search_Key "XM_940724.1" ILMN_Gene "A3GALT2" Accession "NM_001080438.1" Symbol "A3GALT2" Probe_Id "ILMN_1668111" Array_Address_Id "0001740066" nuID "r33p5EJWUK57ZWL3no" seq "TCTTCTGGCTGCACAAGCCCGCCAAGGTGCTGTCGCCCGAGTTCTGCTGG" Now if I BLAT the sequence against GRCh37/hg I get the following. QUERY SCORE START END QSIZE IDENTITY CHRO STRAND START END SPAN YourSeq 50 1 50 50 100.0% 1 - 33772451 33772500 50 Unfortunately this is not near the CDS. If I search UCSC for A3GALT2 I get the following location chr1:33,772,365-33,778,183 Why are the chromosomal locations for this probe different? Chris

Hello, The gene A3GALT2 has been renamed as a pseudogene see Entrez Gene A3GALT2 – alpha 1,3-galactosyltransferase 2 (isoglobotriaosylceramide synthase) [Homo sapiens] alpha 1,3-galactosyltransferase 2 (isoglobotriaosylceramide synthase) Official Symbol: A3GALT2 Chromosome: 1; Location: 1p35.1 This record was replaced with GeneID: 127550 When you blat the probe on UCSC you can see it is in the 3'part (non coding !) of 2 enSembl transcripts A3GALT2P at chr1:33772367-33777822 - (ENST00000330379) A3GALT2P at chr1:33772367-33778491 - (ENST00000442999) Best Philippe Le 15 janv. 2013 à 13:30, Fenton Christopher Graham a écrit : > Illumina mapping nuId to genome coordinates. > >> m2<- read.table("processed_data.csv", header=T, row.names=1, sep="\t") >> probes<- rownames(m2) >> dd<- probeID2nuID(probes) >> seqs<- id2seq(dd[,7]) >> test<- cbind(dd, seqs) > >> test[grep("r33p5EJWUK57ZWL3no", test[,7]),] > > Search_Key "XM_940724.1" > ILMN_Gene "A3GALT2" > Accession "NM_001080438.1" > Symbol "A3GALT2" > Probe_Id "ILMN_1668111" > Array_Address_Id "0001740066" > nuID "r33p5EJWUK57ZWL3no" > seq "TCTTCTGGCTGCACAAGCCCGCCAAGGTGCTGTCGCCCGAGTTCTGCTGG" > > Now if I BLAT the sequence against GRCh37/hg I get the following. > QUERY SCORE START END QSIZE IDENTITY CHRO STRAND START END SPAN > YourSeq 50 1 50 50 100.0% 1 - 33772451 33772500 50 > > Unfortunately this is not near the CDS. > If I search UCSC for A3GALT2 I get the following location > chr1:33,772,365-33,778,183 > > Why are the chromosomal locations for this probe different? > > > Chris > > _______________________________________________ > Bioconductor mailing list > Bioconductor@r-project.org > https://stat.ethz.ch/mailman/listinfo/bioconductor > Search the archives: http://news.gmane.org/gmane.science.biology.informatics.conductor [[alternative HTML version deleted]]