i want to know how this function works? for example: trimLRPatterns(Rpattern = Rpattern, subject = subject, max.Rmismatch=1,with.Lindels=TRUE) subject = "TATAGTAGATATTGGAATAGTACTGTAGGCACCATCAATAGATCGGAA" Rpattern = "GAATAGTACTGTAGGCACCATCAATAGATCGGAA" the function will try to calculate the distance by such coding: sapply((nchar(subject)-nchar(Rpattern)+1):nchar(subject), function(j) { s = substr(subject, j, nchar(subject)) p = substr(Rpattern, 1, nchar(subject)-j+1) neditEndingAtending.at=nchar(s), pattern = p, subject = s, with.indels=TRUE) }) [1] 0 2 4 6 8 10 12 14 15 14 13 12 11 10 9 9 8 7 8 7 6 5 6 6 5 4 4 4 3 2 1 0 [33] 1 1 when the function find the value which is first satisfy the max.Rmismatch value, it will stop in this case,they function will stop at the first position. IF subject = "TATAGTAGATATTGGAATAGTACTGTAGGCACCATCAATAGATCGGAA" Rpattern = "GAATAGTACTGTAGGCACCATCAATAGATCGGTT" The results [1] 2 3 4 6 8 10 12 14 15 14 13 12 11 10 9 9 8 7 8 7 6 5 6 6 5 4 4 4 3 2 1 0 [33] 1 1 it will stop in this case,they function will stop at subject = "TATAGTAGATATTGGAATAGTACTGTAGGCACCATCAATAGATCGGAA" Rpattern = "GAATAGTACTGTAGGCACCATCAATAGATCGGTT" so the shortcoming is the trimLRPatterns cannot find the shared sequence between subject and Rpattern "GAATAGTACTGTAGGCACCATCAATAGATCGG" -- shan gao Room 231(Dr.Fei lab) Boyce Thompson Institute Cornell University Tower Road, Ithaca, NY 14853-1801 Office phone: 1-607-254-1267(day) Official email:sg839 at cornell.edu Facebook:http://www.facebook.com/profile.php?id=100001986532253

Hi there, On 10/30/2012 09:58 AM, wang peter wrote: > i want to know how this function works? > > for example: > trimLRPatterns(Rpattern = Rpattern, subject = subject, > max.Rmismatch=1,with.Lindels=TRUE) > > > subject = "TATAGTAGATATTGGAATAGTACTGTAGGCACCATCAATAGATCGGAA" > Rpattern = "GAATAGTACTGTAGGCACCATCAATAGATCGGAA" > > the function will try to calculate the distance by such coding: > > sapply((nchar(subject)-nchar(Rpattern)+1):nchar(subject), function(j) { > s = substr(subject, j, nchar(subject)) > p = substr(Rpattern, 1, nchar(subject)-j+1) > neditEndingAtending.at=nchar(s), pattern = p, subject = s, > with.indels=TRUE) > }) > [1] 0 2 4 6 8 10 12 14 15 14 13 12 11 10 9 9 8 7 8 7 6 5 > 6 6 5 4 4 4 3 2 1 0 > [33] 1 1 > when the function find the value which is first satisfy the > max.Rmismatch value, it will stop > in this case,they function will stop at the first position. > > IF > subject = "TATAGTAGATATTGGAATAGTACTGTAGGCACCATCAATAGATCGGAA" > Rpattern = "GAATAGTACTGTAGGCACCATCAATAGATCGGTT" > The results > [1] 2 3 4 6 8 10 12 14 15 14 13 12 11 10 9 9 8 7 8 7 6 5 > 6 6 5 4 4 4 3 2 1 0 > [33] 1 1 > it will stop > in this case,they function will stop at > subject = "TATAGTAGATATTGGAATAGTACTGTAGGCACCATCAATAGATCGGAA" > Rpattern = > "GAATAGTACTGTAGGCACCATCAATAGATCGGTT" > > > so the shortcoming is the trimLRPatterns cannot find the shared > sequence between subject and Rpattern > "GAATAGTACTGTAGGCACCATCAATAGATCGG" trimLRPatterns is about trimming the subject by finding/removing the largest possible *prefix* and/or *suffix* in the subject that looks like the left and right pattern, respectively. It's not a tool for finding/removing the longest common substring between the subject and pattern. Note that, in your case, you would get the result I believe you're looking for by just using max.Rmismatch=2 instead of max.Rmismatch=1. Cheers, H. > -- Hervé Pagès Program in Computational Biology Division of Public Health Sciences Fred Hutchinson Cancer Research Center 1100 Fairview Ave. N, M1-B514 P.O. Box 19024 Seattle, WA 98109-1024 E-mail: hpages at fhcrc.org Phone: (206) 667-5791 Fax: (206) 667-1319

Hi, On Tue, Oct 30, 2012 at 4:11 PM, wang peter <wng.peter at="" gmail.com=""> wrote: > thx > i must use another function to do glocal match > and trim them > > rigth? Sounds about right to me. Perhaps you're looking for `matchPattern` or `pairwiseAlignment`? Out of curiosity, are you pre-processing NGS data? If so, what type of reads have artifacts in the center that you want to remove but still "trust" the flanking sequence? -steve -- Steve Lianoglou Graduate Student: Computational Systems Biology | Memorial Sloan-Kettering Cancer Center | Weill Medical College of Cornell University Contact Info: http://cbio.mskcc.org/~lianos/contact