Hi Tim, My bad. I didn't read your email carefully. I don't know if there is anything within BioC for this - you might just need to use BLAST directly. Best, Jim On 8/31/2012 3:47 PM, Tim Smith wrote: > Hi Jim, > > Thanks for the reply. I can get it to work even with the 2 without the > quotes. But how do I get the values that I want (E-value, mismatches > etc.) from the object returned by blastSequences? > > many thanks! > > -------------------------------------------------------------------- ---- > *From:* James W. MacDonald <jmacdon at="" uw.edu=""> > *To:* Tim Smith <tim_smith_666 at="" yahoo.com=""> > *Cc:* bioc <bioconductor at="" stat.math.ethz.ch=""> > *Sent:* Friday, August 31, 2012 3:09 PM > *Subject:* Re: [BioC] BLAST - annotate package? > > Hi Tim, > > Try changing the hitListSize to character: > > > blastSequences(x = > "CAGTTTCTTGAGTCTGATTAATTCAGGTTTCGGGGT",hitListSize="2") > [[1]] > DNAMultipleAlignment with 2 rows and 36 columns > aln > [1] CAGTTTCTTGAGTCTGATTAATTCAGGTTTCGGGGT > [2] CAGTTTCTTGAGTCTGATTAATTCAGGTTTCGGGGT > > [[2]] > DNAMultipleAlignment with 2 rows and 36 columns > aln > [1] CAGTTTCTTGAGTCTGATTAATTCAGGTTTCGGGGT > [2] CAGTTTCTTGAGTCTGATTAATTCAGGTTTCGGGGT > > > Best, > > Jim > > > > On 8/31/2012 2:44 PM, Tim Smith wrote: > > Hi, > > > > Sorry for this basic question - I'm new to BLAST! > > > > I am trying to do BLAST (dna-nucleotide) for a sequence. I want to a > sequence with the rhesus organism. I would like to get the following > values: > > > > 1. Score (bits) > > 2. E-value > > 3. # Matches > > > > > > I am trying to use the 'annotate' package with the following code: > > > > library(annotate) > > xx<- blastSequences(x = > "CAGTTTCTTGAGTCTGATTAATTCAGGTTTCGGGGT",hitListSize=2,program = "blastn") > > > > > > Can (how?) I get the values that I want from the object returned? If > not, which package/function should I be using? Also, is there a > website where I can get the abbreviations for the databases (e.g. is > rhesus = 'rh'?)? > > > > Any pointers in the right direction would be highly appreciated > > > > > > many thanks > > [[alternative HTML version deleted]] > > > > _______________________________________________ > > Bioconductor mailing list > > Bioconductor at r-project.org <mailto:bioconductor at="" r-project.org=""> > > https://stat.ethz.ch/mailman/listinfo/bioconductor > > Search the archives: > http://news.gmane.org/gmane.science.biology.informatics.conductor > > -- > James W. MacDonald, M.S. > Biostatistician > University of Washington > Environmental and Occupational Health Sciences > 4225 Roosevelt Way NE, # 100 > Seattle WA 98105-6099 > > > -- James W. MacDonald, M.S. Biostatistician University of Washington Environmental and Occupational Health Sciences 4225 Roosevelt Way NE, # 100 Seattle WA 98105-6099