Forgot to cc: this to the list initially. Posting for completeness. Sequences are stored as NuIDs in the 450k package (at least for the time being...). > library(IlluminaHumanMethylation450k.db) > IlluminaHumanMethylation450kNUID[['cg00000292']] [1] "caXQ6wu1foImnrDw5U" > library(lumi) > id2seq( IlluminaHumanMethylation450kNUID[['cg00000292']] ) [1] "CGGCCTCAATGGTAAGTGTCCCTTGGAAGAGCGGCTGGTAATTAATGCCC" # first probe sequence in the manifest: > id2seq( IlluminaHumanMethylation450kNUID[['cg00035864']] ) == 'AGACACTAGCAGTCTTGTCCACATAGACCCTTGAATTTATCTCAAATTCG' [1] TRUE Granted, all this crap probably belongs in a separate .probe package... Thanks for the question Khadeeja and for the suggestion Herve. --t On Mon, Jul 25, 2011 at 2:56 AM, Khadeeja Ismail <hajjja@yahoo.com> wrote: > > khadeeja ismail <hajjja@...> writes: > > > > Dear All, > > > > Could someone please tell me how I can get the sequence for any probe > using > the probe IDs in Illumina Human > > Methylation 450k data. > > > > > I have found one solution which is to replace the target IDs in the > lumibatch > object. Wonder if there are any other, such as any that would allow us to > submit > an array of target IDs and reurn the nuIDs. > > Regards, > Hajja > > > > > > > Dear All, > > > > Could someone please tell me how I can get the sequence for any probe > using > the probe IDs in Illumina Human > > Methylation 450k data. > > > > Thanks in advance. > > > > Hajja > > > > [[alternative HTML version deleted]] > > > > _______________________________________________ > > Bioconductor mailing list > > Bioconductor@... > > https://stat.ethz.ch/mailman/listinfo/bioconductor > > Search the archives: > http://news.gmane.org/gmane.science.biology.informatics.conductor > > > > > > _______________________________________________ > Bioconductor mailing list > Bioconductor@r-project.org > https://stat.ethz.ch/mailman/listinfo/bioconductor > Search the archives: > http://news.gmane.org/gmane.science.biology.informatics.conductor > -- If people do not believe that mathematics is simple, it is only because they do not realize how complicated life is. John von Neumann<http: www-groups.dcs.st-="" and.ac.uk="" ~history="" biographies="" von_neumann.html=""> [[alternative HTML version deleted]]