On 11-06-15 11:09 AM, Harris A. Jaffee wrote: > x1 = "AAAAAAAAAATTTTTTTTTTGGGGGGGGGGCCCCCCCCCC" > x2 = "TTTTTTTTTTGGGGGGGGGGCCCCCCCCCCAAAAAAAAAA" > X = DNAStringSet(c(x1, x2)) > > > X > A DNAStringSet instance of length 2 > width seq > [1] 40 AAAAAAAAAATTTTTTTTTTGGGGGGGGGGCCCCCCCCCC > [2] 40 TTTTTTTTTTGGGGGGGGGGCCCCCCCCCCAAAAAAAAAA > >> start1 = 1 >> end1 = 10 >> >> start2 = 21 >> end2 = 25 > > s1 = subseq(X, start1, end1) > s2 = subseq(X, start2, end2) > answer = DNAStringSet(paste(s1, s2, sep="")) Or 'answer = xscat(s1, s2)' would be more efficient here, especially if 's1' and 's2' contain hundreds of thousands of sequences. Cheers, H. > > > answer > A DNAStringSet instance of length 2 > width seq > [1] 15 AAAAAAAAAAGGGGG > [2] 15 TTTTTTTTTTCCCCC > > On Jun 15, 2011, at 7:36 AM, Kristian Ullrich wrote: > >> Hello Biostrings curators, >> >> again the question to you: >> >> Is there an easier way to solve the follwing: >> >> R-code: >> #################### >> #################### >> library(Biostrings) >> >> #example sequence >> seq.list=list() >> seq.list[1]="AAAAAAAAAATTTTTTTTTTGGGGGGGGGGCCCCCCCCCC" >> seq.list[2]="TTTTTTTTTTGGGGGGGGGGCCCCCCCCCCAAAAAAAAAA" >> fas.seq = DNAStringSet(unlist(seq.list)) >> >> #defining start and end points of subseq >> start1 = 1 >> end1 = 10 >> >> start2 = 21 >> end2 = 25 >> >> #creating first and second subseq >> first.subseq = subseq(fas.seq,start1,end1) >> second.subseq = subseq(fas.seq,start2,end2) >> >> new.seq = >> DNAStringSet(apply(sapply(list(first.subseq,second.subseq),as.chara cter),1,function(x) >> paste(x,collapse=""))) >> names(new.seq) = names(fas.seq) >> #################### >> #################### >> >> I basically want to combine subseqs from one DNAStringset, something >> like: >> >> subseq(DNAStringSet, start = c(start1,start2), end = c(end1,end2)) >> >> would be nice. >> >> Thank you in anticipation >> >> Kristian Ullrich >> -- >> Kristian Ullrich >> >> Leibniz Institute of Plant Biochemistry >> Weinberg 3 >> D-06120 Halle (Saale), Germany >> phone +49 345 5582 1221 >> fax +49 345 5582 1209 >> mail kullrich at ipb-halle.de >> >> _______________________________________________ >> Bioconductor mailing list >> Bioconductor at r-project.org >> https://stat.ethz.ch/mailman/listinfo/bioconductor >> Search the archives: >> http://news.gmane.org/gmane.science.biology.informatics.conductor > > _______________________________________________ > Bioconductor mailing list > Bioconductor at r-project.org > https://stat.ethz.ch/mailman/listinfo/bioconductor > Search the archives: > http://news.gmane.org/gmane.science.biology.informatics.conductor -- Hervé Pagès Program in Computational Biology Division of Public Health Sciences Fred Hutchinson Cancer Research Center 1100 Fairview Ave. N, M1-B514 P.O. Box 19024 Seattle, WA 98109-1024 E-mail: hpages at fhcrc.org Phone: (206) 667-5791 Fax: (206) 667-1319