Dear List, I am analyzing mouse Illumina data. I am interested in probes mapping to Akt1... Using BeadStudio, I was able to find such a probe (nuID 3Xqv.fD8.TUv4hRE7o, sequence CCTGGGGTTTTTCTTAATTTATTTCATCCAGTTTGAGACCACACATGTGG)... when I run this sequence against BLAST, it is a perfect match to Akt1 ... also, in the annotation files (from here http://www.compbio.group.cam.ac.uk/Resources/Annotation/), such as MouseWG- 6_V2_0_R0_11278593_A, it is listed as a 100% match to Akt1 (same in the older versions of the annotation files)... however, when i make a call to getSYMBOL ("3Xqv.fD8.TUv4hRE7o", 'lumiMouseAll.db'), the outcome is NA... why is this happening? thanks a lot! Antonina

Hi, Antonia Could you run sessionInfo()? The latest one is 1.10.1 . Let me know if you have any question. Best Gilbert On 5/18/10 7:10 PM, "Antonina Mitrofanova, PhD" <antonina at="" c2b2.columbia.edu=""> wrote: > Dear List, > > I am analyzing mouse Illumina data. I am interested in probes mapping to > Akt1... Using BeadStudio, I was able to find such a probe (nuID > 3Xqv.fD8.TUv4hRE7o, sequence > CCTGGGGTTTTTCTTAATTTATTTCATCCAGTTTGAGACCACACATGTGG)... > > when I run this sequence against BLAST, it is a perfect match to Akt1 ... > > also, in the annotation files (from here > http://www.compbio.group.cam.ac.uk/Resources/Annotation/), such as MouseWG- > 6_V2_0_R0_11278593_A, it is listed as a 100% match to Akt1 (same in the older > versions of the annotation files)... > > however, when i make a call to getSYMBOL > ("3Xqv.fD8.TUv4hRE7o", 'lumiMouseAll.db'), the outcome is NA... > > why is this happening? > > thanks a lot! > Antonina > > _______________________________________________ > Bioconductor mailing list > Bioconductor at stat.math.ethz.ch > https://stat.ethz.ch/mailman/listinfo/bioconductor > Search the archives: > http://news.gmane.org/gmane.science.biology.informatics.conductor