Hi Gilbert, I installed the latest version BioC (2.5) and lumiRatAll.db (1.8.1). But I still can't find the annotation for some the probes, such as nuID = Niuq09_43JW4K1SOe4, as I described in the previous email. Any other suggestion? > sessionInfo() R version 2.10.1 (2009-12-14) i386-apple-darwin9.8.0 locale: [1] en_US.UTF-8/en_US.UTF-8/C/C/en_US.UTF-8/en_US.UTF-8 attached base packages: [1] stats graphics grDevices utils datasets methods base other attached packages: [1] lumiRatAll.db_1.8.1 org.Rn.eg.db_2.3.5 lumiRatIDMapping_1.4.0 [4] limma_3.2.1 lumi_1.12.2 MASS_7.3-4 [7] RSQLite_0.8-1 DBI_0.2-5 preprocessCore_1.8.0 [10] mgcv_1.6-1 affy_1.24.2 annotate_1.24.1 [13] AnnotationDbi_1.8.1 Biobase_2.6.1 loaded via a namespace (and not attached): [1] affyio_1.14.0 grid_2.10.1 lattice_0.17-26 Matrix_0.999375-33 [5] nlme_3.1-96 tools_2.10.1 xtable_1.5-6 Thanks a lot, Flora Gilbert Feng wrote: > Hi, Flora > > It looks you are using the old version lumiMouseAll.db. Please install the > latest version BioC (2.5) and lumiMouseAll.db(1.8.1). > > If you have any more question or comment, just let me know. > > Thanks for using lumi and lumi annotation packages! > > Gilbert > > On 1/20/10 9:40 AM, "Flora Fan" <fanx0038 at="" umn.edu=""> wrote: > > >> Hi, >> >> I am trying to use lumi package to analyze Illumina RatRef-12_V1. >> However, about 30% of the probe IDs don't have annotations in >> lumiRatAll.db_1.6.1. Is it because the mapping didn't pass the threshold >> or am I doing something wrong? >> >> For example, for probe ID ILMN_1355285: >> nuID = Niuq09_43JW4K1SOe4 >> probe seq = GAGGTGGGGTCATTCTTGTGATCTAGCCCGTGAAGGTCCCAGATGCTGTG >> manual blast result as well as Illumina annotation file >> RatRef-12_V1_0_R3_11222119_A.txt shows that it mapped to A4galt. >> >> But when I do getSYMBOL, no symbol was returned. >> >>> getSYMBOL("Niuq09_43JW4K1SOe4","lumiRatAll.db") >>> >> Niuq09_43JW4K1SOe4 >> NA >> or >> >>> x<- lumiRatAllACCNUM >>> mapped_probes <- mappedkeys(x) >>> ind<-c(1:16134)[mapped_probes == "Niuq09_43JW4K1SOe4"] >>> >> It returned integer(0) >> >> How can I annotate these IDs? Can I keep the original gene symbols that >> were generated from GenomeStudio version 1.0.6 as identifiers in lumi >> package? >> >> Here is the sessionInfo() >> R version 2.9.1 (2009-06-26) >> i386-apple-darwin8.11.1 >> >> locale: >> en_US.UTF-8/en_US.UTF-8/C/C/en_US.UTF-8/en_US.UTF-8 >> >> attached base packages: >> [1] stats graphics grDevices utils datasets methods base >> >> other attached packages: >> [1] lumiRatAll.db_1.6.1 lumiRatV1_1.2.0 beadarray_1.12.1 >> [4] hwriter_1.1 lumiRatIDMapping_1.2.1 limma_2.18.0 >> [7] lumi_1.10.2 RSQLite_0.7-1 DBI_0.2-4 >> [10] preprocessCore_1.6.0 mgcv_1.5-5 affy_1.22.0 >> [13] annotate_1.22.0 AnnotationDbi_1.6.0 Biobase_2.4.1 >> >> loaded via a namespace (and not attached): >> [1] affyio_1.12.0 grid_2.9.1 lattice_0.17-25 nlme_3.1-92 >> [5] tools_2.9.1 xtable_1.5-5 >> >> Your help will be greatly appreciated. >> -Flora >> > > > >