R: R: How can I trace back transcription target genes from the miRNAs file downloadable from miRbase ?
2
0
Entering edit mode
@mauedealiceit-3511
Last seen 10.2 years ago
Thank you very much: I am sure my desperate search for Validated sequences will bnefit from the package you kindly suggested. Best regards, Maura -----Messaggio originale----- Da: Chao-Jen Wong [mailto:cwon2@fhcrc.org] Inviato: ven 02/10/2009 20.15 A: mauede@alice.it Cc: Bioconductor List Oggetto: Re: [BioC] R: How can I trace back transcription target genes from the miRNAs file downloadable from miRbase ? Hi, Maura, You can possibly find the microRNA package useful for your task. It contains the database from miRBase along with the target genes. You can then use this database to find the sequence using biomaRt. This package does not have a vignette. To find the help and the target genes list of hsa-miR-xxx, you can do the following: >help(package="microRNA") >?hsTarget >?s3utr >?hsSeqs > head(hsTargets) name target chrom start end strand 1 hsa-miR-647 ENST00000295228 2 120824263 120824281 + 2 hsa-miR-130a ENST00000295228 2 120825363 120825385 + 3 hsa-miR-423-3p ENST00000295228 2 120825191 120825213 + 4 hsa-miR-423-5p ENST00000295228 2 120824821 120824843 + 5 hsa-miR-130b ENST00000295228 2 120825364 120825385 + 6 hsa-miR-767-3p ENST00000295228 2 120824258 120824278 + As for the difference between mirBase and miRecord (i.e., hsa-miR- 26a*), unless miRecord can update their database, there is no resolution for hsa-miR-26a-01 and -02 are totally different microRNA located at different chromosome. Regards, Chao-Jen mauede@alice.it wrote: > My first task was to download a set (as big as posssible) of experimentally Validated miRNAs from miRecords with their relative target genes > and the 3'UTR sequences., limited to Homo sapiens. > The XLS file from miRecords related the miRNA identier ("hsa-miR- xxx) with its target genes identifier. I never found a clear way to download > the miRNA sequence and the relative target 3'UTR sequence from miRecords. The many different links bring to pages of sequences that > are not expressively stated to be what I need. Therefore I downloaded the Validated miRNAs file from miRbase, matched the miRNA identifier > with miRecords to get the miRNA sequence. Then I used the gene identifier (NM_yyyy) from miRecords to quey BioMart and get the 3'UTR sequences. > There are many unresolved miRNAs because I cannot find an exact match between the miRecords and miRbase. For example in mirBase I > found two miRNAs whose identifiers differ only by the last digit but their sequences are different beyond the seed region so their are (I think) > two different entities: > > hsa-miR-26a-1* MIMAT0004499 Homo sapiens miR-26a-1* > "CCUAUUCUUGGUUACUUGCACG" > >> val_miRNA[830] >> > hsa-miR-26a-2* MIMAT0004681 Homo sapiens miR-26a-2* > "CCUAUUCUUGAUUACUUGUUUC" > > miRecords XLS file only contains "hsa-miR-26a" that I cannot match to either one above mentioned. > I can only use the Validated miRNAs from miRecords for which I find a match in mirBase. > > My question is: if I restrict my search to mirBase, where can I find the experimentally Validated (not just predicted) > target genes associated to the miRNAs in the downloadable files containing records like the above shown ones ? > The data MIMATsssss does not seem to bring me anywhere .... > To complete my task I have to find the Validated target identifiers (for instance NM_xxxxxx) and then use this data to > query BioMart and get the 3'UTR sequences. > > Thank you in advance, > Maura > > > -----Messaggio originale----- > Da: Sean Davis [mailto:seandavi@gmail.com] > Inviato: ven 02/10/2009 4.22 > A: mauede@alice.it > Cc: Bioconductor List > Oggetto: Re: [BioC] How can I trace back transcription target genes from the miRNAs file downloadable from miRbase ? > > On Thu, Oct 1, 2009 at 9:27 PM, <mauede@alice.it> wrote: > >> I downloaded the Validated miRNAs files (mirbase/CURRENT/mature.fa.gz , maturestar.fa). >> How can I trace back to the gene transcription sequence for the genes that targeted any specifi miRNA ' >> Thank you in advance, >> Maura >> > > Hi, Maura. Are you asking to find the targets of miRNAs? Or are you > asking for the sequences of transcripts? > > Sean > > > > tutti i telefonini TIM! > > > [[alternative HTML version deleted]] > > _______________________________________________ > Bioconductor mailing list > Bioconductor@stat.math.ethz.ch > https://stat.ethz.ch/mailman/listinfo/bioconductor > Search the archives: http://news.gmane.org/gmane.science.biology.informatics.conductor > -- Chao-Jen Wong Program in Computational Biology Division of Public Health Sciences Fred Hutchinson Cancer Research Center 1100 Fairview Avenue N., M2-B876 PO Box 19024 Seattle, WA 98109 206.667.4485 cwon2@fhcrc.org tutti i telefonini TIM! [[alternative HTML version deleted]]
Transcription miRNA Cancer Homo sapiens biomaRt microRNA Transcription miRNA Cancer • 1.6k views
ADD COMMENT •
0
Entering edit mode
@mauedealiceit-3511
Last seen 10.2 years ago
This will be a future step. I am a bginner in this field therefore I might be mistaken. TargetScan is a s/w code for miRNAs targets prediction, am I right ? So far I need to work on miRNAs (and related targets) that have been experimentally validated. But in the following step I will need to test out code against any miRNA. Actually, at that point we will explicitly look for miRNAs that haven't been validated from any lab yet. I will probably bother you again when I try out the package you suggested... on Monday as during wekends I am working on another project. Thank you very much, Maura -----Messaggio originale----- Da: Chao-Jen Wong [mailto:cwon2@fhcrc.org] Inviato: ven 02/10/2009 20.38 A: mauede@alice.it Cc: Bioconductor List Oggetto: Re: [BioC] R: How can I trace back transcription target genes from the miRNAs file downloadable from miRbase ? In addition to the microRNA package, you can try TargetScan www.targetscan.org). Their miRNA ID are consistent with mirBase, and the gene IDs correspond to Entrez IDs, which you can easily use them to extract their sequence usin gbiomaRt. Hope this would help. Ps: You can download their database through http://www.targetscan.org/cgi- bin/targetscan/data_download.cgi?db=vert_50 Chao-Jen Wong wrote: > Hi, Maura, > > You can possibly find the microRNA package useful for your task. It > contains the database from miRBase along with the target genes. You can > then use this database to find the sequence using biomaRt. This > package does not have a vignette. To find the help and the target genes > list of hsa-miR-xxx, you can do the following: > > >> help(package="microRNA") >> ?hsTarget >> ?s3utr >> ?hsSeqs >> head(hsTargets) >> > name target chrom start end strand > 1 hsa-miR-647 ENST00000295228 2 120824263 120824281 + > 2 hsa-miR-130a ENST00000295228 2 120825363 120825385 + > 3 hsa-miR-423-3p ENST00000295228 2 120825191 120825213 + > 4 hsa-miR-423-5p ENST00000295228 2 120824821 120824843 + > 5 hsa-miR-130b ENST00000295228 2 120825364 120825385 + > 6 hsa-miR-767-3p ENST00000295228 2 120824258 120824278 + > > As for the difference between mirBase and miRecord (i.e., hsa-miR- 26a*), > unless miRecord can update their database, there is no resolution for > hsa-miR-26a-01 and -02 are totally different microRNA located at > different chromosome. > > Regards, > Chao-Jen > > mauede@alice.it wrote: > >> My first task was to download a set (as big as posssible) of experimentally Validated miRNAs from miRecords with their relative target genes >> and the 3'UTR sequences., limited to Homo sapiens. >> The XLS file from miRecords related the miRNA identier ("hsa-miR- xxx) with its target genes identifier. I never found a clear way to download >> the miRNA sequence and the relative target 3'UTR sequence from miRecords. The many different links bring to pages of sequences that >> are not expressively stated to be what I need. Therefore I downloaded the Validated miRNAs file from miRbase, matched the miRNA identifier >> with miRecords to get the miRNA sequence. Then I used the gene identifier (NM_yyyy) from miRecords to quey BioMart and get the 3'UTR sequences. >> There are many unresolved miRNAs because I cannot find an exact match between the miRecords and miRbase. For example in mirBase I >> found two miRNAs whose identifiers differ only by the last digit but their sequences are different beyond the seed region so their are (I think) >> two different entities: >> >> hsa-miR-26a-1* MIMAT0004499 Homo sapiens miR-26a-1* >> "CCUAUUCUUGGUUACUUGCACG" >> >> >>> val_miRNA[830] >>> >>> >> hsa-miR-26a-2* MIMAT0004681 Homo sapiens miR-26a-2* >> "CCUAUUCUUGAUUACUUGUUUC" >> >> miRecords XLS file only contains "hsa-miR-26a" that I cannot match to either one above mentioned. >> I can only use the Validated miRNAs from miRecords for which I find a match in mirBase. >> >> My question is: if I restrict my search to mirBase, where can I find the experimentally Validated (not just predicted) >> target genes associated to the miRNAs in the downloadable files containing records like the above shown ones ? >> The data MIMATsssss does not seem to bring me anywhere .... >> To complete my task I have to find the Validated target identifiers (for instance NM_xxxxxx) and then use this data to >> query BioMart and get the 3'UTR sequences. >> >> Thank you in advance, >> Maura >> >> >> -----Messaggio originale----- >> Da: Sean Davis [mailto:seandavi@gmail.com] >> Inviato: ven 02/10/2009 4.22 >> A: mauede@alice.it >> Cc: Bioconductor List >> Oggetto: Re: [BioC] How can I trace back transcription target genes from the miRNAs file downloadable from miRbase ? >> >> On Thu, Oct 1, 2009 at 9:27 PM, <mauede@alice.it> wrote: >> >> >>> I downloaded the Validated miRNAs files (mirbase/CURRENT/mature.fa.gz , maturestar.fa). >>> How can I trace back to the gene transcription sequence for the genes that targeted any specifi miRNA ' >>> Thank you in advance, >>> Maura >>> >>> >> Hi, Maura. Are you asking to find the targets of miRNAs? Or are you >> asking for the sequences of transcripts? >> >> Sean >> >> >> >> tutti i telefonini TIM! >> >> >> [[alternative HTML version deleted]] >> >> _______________________________________________ >> Bioconductor mailing list >> Bioconductor@stat.math.ethz.ch >> https://stat.ethz.ch/mailman/listinfo/bioconductor >> Search the archives: http://news.gmane.org/gmane.science.biology.informatics.conductor >> >> > > > -- Chao-Jen Wong Program in Computational Biology Division of Public Health Sciences Fred Hutchinson Cancer Research Center 1100 Fairview Avenue N., M2-B876 PO Box 19024 Seattle, WA 98109 206.667.4485 cwon2@fhcrc.org tutti i telefonini TIM! [[alternative HTML version deleted]]
ADD COMMENT •
0
Entering edit mode
@mauedealiceit-3511
Last seen 10.2 years ago
I installed microRNA package. I would expect to get access to the miRNAs sequences and their target genes sequences through such a package. But this is not the case. In fact when I enter the following command: > data(hsSeqs) > nothing appears on R consolle. Even if I try to assign the result of the data statement to an R data variable I get a vector, of length 1, that contains the set name, as shown in the following: > HSmiRNAs <- data(hsSeqs) > HSmiRNAs [1] "hsSeqs" > is.vector(HSmiRNAs) [1] TRUE > length(HSmiRNAs) [1] 1 Maybe I am missing something .... ? Thank you, Maura -----Messaggio originale----- Da: Chao-Jen Wong [mailto:cwon2@fhcrc.org] Inviato: ven 02/10/2009 20.15 A: mauede@alice.it Cc: Bioconductor List Oggetto: Re: [BioC] R: How can I trace back transcription target genes from the miRNAs file downloadable from miRbase ? Hi, Maura, You can possibly find the microRNA package useful for your task. It contains the database from miRBase along with the target genes. You can then use this database to find the sequence using biomaRt. This package does not have a vignette. To find the help and the target genes list of hsa-miR-xxx, you can do the following: >help(package="microRNA") >?hsTarget >?s3utr >?hsSeqs > head(hsTargets) name target chrom start end strand 1 hsa-miR-647 ENST00000295228 2 120824263 120824281 + 2 hsa-miR-130a ENST00000295228 2 120825363 120825385 + 3 hsa-miR-423-3p ENST00000295228 2 120825191 120825213 + 4 hsa-miR-423-5p ENST00000295228 2 120824821 120824843 + 5 hsa-miR-130b ENST00000295228 2 120825364 120825385 + 6 hsa-miR-767-3p ENST00000295228 2 120824258 120824278 + As for the difference between mirBase and miRecord (i.e., hsa-miR- 26a*), unless miRecord can update their database, there is no resolution for hsa-miR-26a-01 and -02 are totally different microRNA located at different chromosome. Regards, Chao-Jen mauede@alice.it wrote: > My first task was to download a set (as big as posssible) of experimentally Validated miRNAs from miRecords with their relative target genes > and the 3'UTR sequences., limited to Homo sapiens. > The XLS file from miRecords related the miRNA identier ("hsa-miR- xxx) with its target genes identifier. I never found a clear way to download > the miRNA sequence and the relative target 3'UTR sequence from miRecords. The many different links bring to pages of sequences that > are not expressively stated to be what I need. Therefore I downloaded the Validated miRNAs file from miRbase, matched the miRNA identifier > with miRecords to get the miRNA sequence. Then I used the gene identifier (NM_yyyy) from miRecords to quey BioMart and get the 3'UTR sequences. > There are many unresolved miRNAs because I cannot find an exact match between the miRecords and miRbase. For example in mirBase I > found two miRNAs whose identifiers differ only by the last digit but their sequences are different beyond the seed region so their are (I think) > two different entities: > > hsa-miR-26a-1* MIMAT0004499 Homo sapiens miR-26a-1* > "CCUAUUCUUGGUUACUUGCACG" > >> val_miRNA[830] >> > hsa-miR-26a-2* MIMAT0004681 Homo sapiens miR-26a-2* > "CCUAUUCUUGAUUACUUGUUUC" > > miRecords XLS file only contains "hsa-miR-26a" that I cannot match to either one above mentioned. > I can only use the Validated miRNAs from miRecords for which I find a match in mirBase. > > My question is: if I restrict my search to mirBase, where can I find the experimentally Validated (not just predicted) > target genes associated to the miRNAs in the downloadable files containing records like the above shown ones ? > The data MIMATsssss does not seem to bring me anywhere .... > To complete my task I have to find the Validated target identifiers (for instance NM_xxxxxx) and then use this data to > query BioMart and get the 3'UTR sequences. > > Thank you in advance, > Maura > > > -----Messaggio originale----- > Da: Sean Davis [mailto:seandavi@gmail.com] > Inviato: ven 02/10/2009 4.22 > A: mauede@alice.it > Cc: Bioconductor List > Oggetto: Re: [BioC] How can I trace back transcription target genes from the miRNAs file downloadable from miRbase ? > > On Thu, Oct 1, 2009 at 9:27 PM, <mauede@alice.it> wrote: > >> I downloaded the Validated miRNAs files (mirbase/CURRENT/mature.fa.gz , maturestar.fa). >> How can I trace back to the gene transcription sequence for the genes that targeted any specifi miRNA ' >> Thank you in advance, >> Maura >> > > Hi, Maura. Are you asking to find the targets of miRNAs? Or are you > asking for the sequences of transcripts? > > Sean > > > > tutti i telefonini TIM! > > > [[alternative HTML version deleted]] > > _______________________________________________ > Bioconductor mailing list > Bioconductor@stat.math.ethz.ch > https://stat.ethz.ch/mailman/listinfo/bioconductor > Search the archives: http://news.gmane.org/gmane.science.biology.informatics.conductor > -- Chao-Jen Wong Program in Computational Biology Division of Public Health Sciences Fred Hutchinson Cancer Research Center 1100 Fairview Avenue N., M2-B876 PO Box 19024 Seattle, WA 98109 206.667.4485 cwon2@fhcrc.org tutti i telefonini TIM! [[alternative HTML version deleted]]
ADD COMMENT •
0
Entering edit mode
On Thu, Oct 8, 2009 at 5:54 AM, <mauede@alice.it> wrote: > I installed microRNA package. > I would expect to get access to the miRNAs sequences and their target genes > sequences through such a package. > But this is not the case. In fact when I enter the following command: > > data(hsSeqs) > > > nothing appears on R consolle. > Even if I try to assign the result of the data statement to an R data > variable I get a vector, of length 1, that contains the set name, as shown > in the following: > > > HSmiRNAs <- data(hsSeqs) > > HSmiRNAs > [1] "hsSeqs" > > is.vector(HSmiRNAs) > [1] TRUE > > length(HSmiRNAs) > [1] 1 > > Maybe I am missing something .... ? > > Hi, Maura. Does ?data give you any hints? I find it useful to read the help file for all functions that are new to me. Also, I'm assuming that you are looking through the R manuals before asking questions on the list: http://watson.nci.nih.gov/cran_mirror/doc/manuals/R-intro.html #Accessing-builtin-datasets If things are still unclear, try this experiment: data(hsSeqs) head(hsSeqs) Hope that helps, Sean > Thank you, > Maura > > -----Messaggio originale----- > Da: Chao-Jen Wong [mailto:cwon2@fhcrc.org] > Inviato: ven 02/10/2009 20.15 > A: mauede@alice.it > Cc: Bioconductor List > Oggetto: Re: [BioC] R: How can I trace back transcription target genes from > the miRNAs file downloadable from miRbase ? > > Hi, Maura, > > You can possibly find the microRNA package useful for your task. It > contains the database from miRBase along with the target genes. You can > then use this database to find the sequence using biomaRt. This > package does not have a vignette. To find the help and the target genes > list of hsa-miR-xxx, you can do the following: > > >help(package="microRNA") > >?hsTarget > >?s3utr > >?hsSeqs > > head(hsTargets) > name target chrom start end strand > 1 hsa-miR-647 ENST00000295228 2 120824263 120824281 + > 2 hsa-miR-130a ENST00000295228 2 120825363 120825385 + > 3 hsa-miR-423-3p ENST00000295228 2 120825191 120825213 + > 4 hsa-miR-423-5p ENST00000295228 2 120824821 120824843 + > 5 hsa-miR-130b ENST00000295228 2 120825364 120825385 + > 6 hsa-miR-767-3p ENST00000295228 2 120824258 120824278 + > > As for the difference between mirBase and miRecord (i.e., hsa-miR- 26a*), > unless miRecord can update their database, there is no resolution for > hsa-miR-26a-01 and -02 are totally different microRNA located at > different chromosome. > > Regards, > Chao-Jen > > mauede@alice.it wrote: > > My first task was to download a set (as big as posssible) of > experimentally Validated miRNAs from miRecords with their relative target > genes > > and the 3'UTR sequences., limited to Homo sapiens. > > The XLS file from miRecords related the miRNA identier ("hsa-miR- xxx) > with its target genes identifier. I never found a clear way to download > > the miRNA sequence and the relative target 3'UTR sequence from miRecords. > The many different links bring to pages of sequences that > > are not expressively stated to be what I need. Therefore I downloaded > the Validated miRNAs file from miRbase, matched the miRNA identifier > > with miRecords to get the miRNA sequence. Then I used the gene identifier > (NM_yyyy) from miRecords to quey BioMart and get the 3'UTR sequences. > > There are many unresolved miRNAs because I cannot find an exact match > between the miRecords and miRbase. For example in mirBase I > > found two miRNAs whose identifiers differ only by the last digit but > their sequences are different beyond the seed region so their are (I think) > > two different entities: > > > > hsa-miR-26a-1* MIMAT0004499 Homo sapiens miR-26a-1* > > "CCUAUUCUUGGUUACUUGCACG" > > > >> val_miRNA[830] > >> > > hsa-miR-26a-2* MIMAT0004681 Homo sapiens miR-26a-2* > > "CCUAUUCUUGAUUACUUGUUUC" > > > > miRecords XLS file only contains "hsa-miR-26a" that I cannot match to > either one above mentioned. > > I can only use the Validated miRNAs from miRecords for which I find a > match in mirBase. > > > > My question is: if I restrict my search to mirBase, where can I find the > experimentally Validated (not just predicted) > > target genes associated to the miRNAs in the downloadable files > containing records like the above shown ones ? > > The data MIMATsssss does not seem to bring me anywhere .... > > To complete my task I have to find the Validated target identifiers (for > instance NM_xxxxxx) and then use this data to > > query BioMart and get the 3'UTR sequences. > > > > Thank you in advance, > > Maura > > > > > > -----Messaggio originale----- > > Da: Sean Davis [mailto:seandavi@gmail.com] > > Inviato: ven 02/10/2009 4.22 > > A: mauede@alice.it > > Cc: Bioconductor List > > Oggetto: Re: [BioC] How can I trace back transcription target genes from > the miRNAs file downloadable from miRbase ? > > > > On Thu, Oct 1, 2009 at 9:27 PM, <mauede@alice.it> wrote: > > > >> I downloaded the Validated miRNAs files (mirbase/CURRENT/mature.fa.gz , > maturestar.fa). > >> How can I trace back to the gene transcription sequence for the genes > that targeted any specifi miRNA ' > >> Thank you in advance, > >> Maura > >> > > > > Hi, Maura. Are you asking to find the targets of miRNAs? Or are you > > asking for the sequences of transcripts? > > > > Sean > > > > > > > > tutti i telefonini TIM! > > > > > > [[alternative HTML version deleted]] > > > > _______________________________________________ > > Bioconductor mailing list > > Bioconductor@stat.math.ethz.ch > > https://stat.ethz.ch/mailman/listinfo/bioconductor > > Search the archives: > http://news.gmane.org/gmane.science.biology.informatics.conductor > > > > > -- > Chao-Jen Wong > Program in Computational Biology > Division of Public Health Sciences > Fred Hutchinson Cancer Research Center > 1100 Fairview Avenue N., M2-B876 > PO Box 19024 > Seattle, WA 98109 > 206.667.4485 > cwon2@fhcrc.org > > > > > > tutti i telefonini TIM! > > > [[alternative HTML version deleted]] > > _______________________________________________ > Bioconductor mailing list > Bioconductor@stat.math.ethz.ch > https://stat.ethz.ch/mailman/listinfo/bioconductor > Search the archives: > http://news.gmane.org/gmane.science.biology.informatics.conductor > [[alternative HTML version deleted]]
ADD REPLY •

Login before adding your answer.

Similar Posts
Loading Similar Posts
Traffic: 663 users visited in the last hour
Content Search
Users
Tags
Badges
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6