In addition to the microRNA package, you can try TargetScan www.targetscan.org). Their miRNA ID are consistent with mirBase, and the gene IDs correspond to Entrez IDs, which you can easily use them to extract their sequence usin gbiomaRt. Hope this would help. Ps: You can download their database through http://www.targetscan.org/cgi- bin/targetscan/data_download.cgi?db=vert_50 Chao-Jen Wong wrote: > Hi, Maura, > > You can possibly find the microRNA package useful for your task. It > contains the database from miRBase along with the target genes. You can > then use this database to find the sequence using biomaRt. This > package does not have a vignette. To find the help and the target genes > list of hsa-miR-xxx, you can do the following: > > >> help(package="microRNA") >> ?hsTarget >> ?s3utr >> ?hsSeqs >> head(hsTargets) >> > name target chrom start end strand > 1 hsa-miR-647 ENST00000295228 2 120824263 120824281 + > 2 hsa-miR-130a ENST00000295228 2 120825363 120825385 + > 3 hsa-miR-423-3p ENST00000295228 2 120825191 120825213 + > 4 hsa-miR-423-5p ENST00000295228 2 120824821 120824843 + > 5 hsa-miR-130b ENST00000295228 2 120825364 120825385 + > 6 hsa-miR-767-3p ENST00000295228 2 120824258 120824278 + > > As for the difference between mirBase and miRecord (i.e., hsa-miR- 26a*), > unless miRecord can update their database, there is no resolution for > hsa-miR-26a-01 and -02 are totally different microRNA located at > different chromosome. > > Regards, > Chao-Jen > > mauede at alice.it wrote: > >> My first task was to download a set (as big as posssible) of experimentally Validated miRNAs from miRecords with their relative target genes >> and the 3'UTR sequences., limited to Homo sapiens. >> The XLS file from miRecords related the miRNA identier ("hsa-miR- xxx) with its target genes identifier. I never found a clear way to download >> the miRNA sequence and the relative target 3'UTR sequence from miRecords. The many different links bring to pages of sequences that >> are not expressively stated to be what I need. Therefore I downloaded the Validated miRNAs file from miRbase, matched the miRNA identifier >> with miRecords to get the miRNA sequence. Then I used the gene identifier (NM_yyyy) from miRecords to quey BioMart and get the 3'UTR sequences. >> There are many unresolved miRNAs because I cannot find an exact match between the miRecords and miRbase. For example in mirBase I >> found two miRNAs whose identifiers differ only by the last digit but their sequences are different beyond the seed region so their are (I think) >> two different entities: >> >> hsa-miR-26a-1* MIMAT0004499 Homo sapiens miR-26a-1* >> "CCUAUUCUUGGUUACUUGCACG" >> >> >>> val_miRNA[830] >>> >>> >> hsa-miR-26a-2* MIMAT0004681 Homo sapiens miR-26a-2* >> "CCUAUUCUUGAUUACUUGUUUC" >> >> miRecords XLS file only contains "hsa-miR-26a" that I cannot match to either one above mentioned. >> I can only use the Validated miRNAs from miRecords for which I find a match in mirBase. >> >> My question is: if I restrict my search to mirBase, where can I find the experimentally Validated (not just predicted) >> target genes associated to the miRNAs in the downloadable files containing records like the above shown ones ? >> The data MIMATsssss does not seem to bring me anywhere .... >> To complete my task I have to find the Validated target identifiers (for instance NM_xxxxxx) and then use this data to >> query BioMart and get the 3'UTR sequences. >> >> Thank you in advance, >> Maura >> >> >> -----Messaggio originale----- >> Da: Sean Davis [mailto:seandavi at gmail.com] >> Inviato: ven 02/10/2009 4.22 >> A: mauede at alice.it >> Cc: Bioconductor List >> Oggetto: Re: [BioC] How can I trace back transcription target genes from the miRNAs file downloadable from miRbase ? >> >> On Thu, Oct 1, 2009 at 9:27 PM, <mauede at="" alice.it=""> wrote: >> >> >>> I downloaded the Validated miRNAs files (mirbase/CURRENT/mature.fa.gz , maturestar.fa). >>> How can I trace back to the gene transcription sequence for the genes that targeted any specifi miRNA ' >>> Thank you in advance, >>> Maura >>> >>> >> Hi, Maura. Are you asking to find the targets of miRNAs? Or are you >> asking for the sequences of transcripts? >> >> Sean >> >> >> >> tutti i telefonini TIM! >> >> >> [[alternative HTML version deleted]] >> >> _______________________________________________ >> Bioconductor mailing list >> Bioconductor at stat.math.ethz.ch >> https://stat.ethz.ch/mailman/listinfo/bioconductor >> Search the archives: http://news.gmane.org/gmane.science.biology.informatics.conductor >> >> > > > -- Chao-Jen Wong Program in Computational Biology Division of Public Health Sciences Fred Hutchinson Cancer Research Center 1100 Fairview Avenue N., M2-B876 PO Box 19024 Seattle, WA 98109 206.667.4485 cwon2 at fhcrc.org