Entering edit mode
mauede@alice.it
▴
870
@mauedealiceit-3511
Last seen 10.4 years ago
Sorry for my misuse of Biology nomenclature. I am still very confused.
My first task (very trivial for you) is to generate a text files
containing a list of Homo-Sapiens validated miRNAs (microRNA-
identifier, sequence)
and relative 3'UTR regions (gene-identifier, 3'UTR-sequence).
I realize this is just a matter of retrieving all known information.
The difficulty for me is where to find the pair (miRNA, gene-3'UTR)
matching information.
In the following I downloaded a lot of stuff but I do not know how to
put the pieces together to fulfill my task.
I think the 3'UTR sequences can be retrieved through function
"getSequence" from package "biomaRt"m .... if only I knew which
parameters to pass to such a function to achieve my goal.
1) Function "hsSeqs" from package "microRNA" produces 677 miRNAs
entries
ex. hsa-let-7a "UGAGGUAGUAGGUUGUAUAGUU"
Are such miRNAs validated ?
If the answer is "yes" then how can I retrieve the correspondent
gene-3'UTR regions ?
2) Function "hsSeqs" from package "microRNA" produces a matrix 709015x
6 contaiing miRNA identifiers
and apparently some data from the paired gene.
ex. name target chrom start end
strand
[1,] "hsa-miR-647" "ENST00000295228" "2" "120824263"
"120824281" "+"
[2,] "hsa-miR-130a" "ENST00000295228" "2" "120825363"
"120825385" "+"
Again. how can I retrieve the correspondent gene-3'UTR regions from
the above data ?
3) Function "s3utr" from package "microRNA" produces 112 3'UTR
entries
ex. "CCTGCCCGCCCGCATGGCCAGCCAGTGGCAAGCTGCCGCCCCCACTCTCCGGGCACCGTCTCCTG
CCTGTGCGTCCGCCC
ACCGCTGCCCTGTCTGTTGCGACACCCTCCCCCCCACATACACACGCAGCGTTTTGATAAATT
ATTGGTTTTCAACG"
Where do such 3'UTR come from ? Which (miRNA, gene) do they belong
to ?
4) I downloaded the file "mature.fa" (Fasta format sequences of all
mature miRNA sequences) from
http://microrna.sanger.ac.uk/sequences/ftp.shtml
The file contais a number of records starting withthe miRNA
identifier.
ex: hsa-miR-943 miRanda miRNA_target 9885484 9885504
15.6748 4.721740e-02 + . URL
"http://www.ensembl.org/homo_sapiens/geneview?gene=ENST00000302092"
hsa-miR-944 miRanda miRNA_target 9885188 9885209 16.602
1.659470e-03 + . URL
"http://www.ensembl.org/homo_sapiens/geneview?gene=ENST00000302092"
Where are the 3'UTR regions indicated in the above records ?
5) I downloaded miRNA Validated Targets from
http://mirecords.umn.edu/miRecords/download.php.
It generated a huge XLS file with alot of data.
ex: Pubmed_id Target gene_species_scientific Target
gene_species_common Target gene_name Target
gene_Refseq_acc Target site_number miRNA_species
miRNA_mature_ID miRNA_regulation Reporter_target gene/region
Reporter link element Test_method_inter Target gene mRNA_level
Original description Mutation_target region Post mutation_method
Original description_mutation_region Target site_position A
Reporter_target site Reporter link element Test_method_inter_site
Original description_inter_site Mutation_target site Post
mutation_method_site Original description_mutation_site
Mutiple site mutation note Additional note
12808467 Homo sapiens human Hes1 NM_198155.2 1
Homo sapiens hsa-miR-23a mutation
Western blotting Next, to examine whether expression of
the gene for Hes1 is regulated by miR-23, we introduced synthetic
miR-23 or mutant miR-23 (Fig. 2a) into undifferentiated NT2 cells.
When synthetic miR-23 was introduced at 2 mMinto undifferentiated NT2
cells,the intracellular level of Hes1 fell significantly (Fig. 2b).By
contrast,in the presence of synthetic mutant miR-23,the level of Hes1
in undifferentiated NT2 cells remained unchanged and similar to that
in untreated wild-type NT2 cells (Fig. 2b).
801 overexpression by mature miRNA transfection luciferase
target site(five copies of the target sequence) activity assay
Furthermore, the luciferase activity of LucÐTS23 in undifferentiated
NT2 cells that had been treated with synthetic miR-23 was lower than
that in untreated wild-type NT2 cells (Fig. 3c). Yes
Luciferase activity assay Furthermore, the luciferase activity
of LucÐTS23 in undifferentiated NT2 cells that had been treated with
synthetic miR-23 was lower than that in untreated wild-type NT2 cells
(Fig. 3c).
Thank you in advance for helping me out of my misery.
Maura
[[alternative HTML version deleted]]