Hi Paul, the issue is fixed in the latest RCurl which you can install by source("http://www.bioconductor.org/biocLite.R") biocLite("RCurl") For some reason this didn't pick up the dependency on bitops on my my machine, so to be safe you might want to do biocLite(c("bitops", "RCurl")) Please check if the fixes the problem on your end, if not we need the reproducible example Tony was suggesting before. Florian On 28.05.2009, at 21:56, Paul Leo wrote: > I (and I assume most) have no problem with the "standard" config > below. > Worth depreciating ? > >> sessionInfo() > R version 2.9.0 (2009-04-17) > x86_64-pc-linux-gnu > > locale: > LC_CTYPE > = > en_AU > .UTF > -8 > ;LC_NUMERIC > = > C > ;LC_TIME > = > en_AU > .UTF > -8 > ;LC_COLLATE > = > en_AU > .UTF > -8 > ;LC_MONETARY > = > C > ;LC_MESSAGES > = > en_AU > .UTF > -8 > ;LC_PAPER > = > en_AU > .UTF > -8 > ;LC_NAME > = > C > ;LC_ADDRESS > =C;LC_TELEPHONE=C;LC_MEASUREMENT=en_AU.UTF-8;LC_IDENTIFICATION=C > > attached base packages: > [1] stats graphics grDevices utils datasets methods base > > other attached packages: > [1] biomaRt_2.0.0 > > loaded via a namespace (and not attached): > [1] RCurl_0.94-1 XML_1.95-3 >> > > > -----Original Message----- > From: James Bullard <bullard at="" berkeley.edu=""> > To: whuber at embl.de > Cc: Bioconductor <bioconductor at="" stat.math.ethz.ch=""> > Subject: Re: [BioC] biomaRt - current devel version of biomaRt+RCurl > don't work > Date: Thu, 28 May 2009 14:00:04 -0700 > > Hi, I am having problems with biomaRt and based on Wolfgang's post it > looks like I shouldn't be (or am I being completely naive?): > > Thanks, jim > >> library("biomaRt") >> mart = useMart("ensembl") >> ensembl = useDataset("hsapiens_gene_ensembl", > + mart=mart) > Checking attributes ... ok > Checking filters ... ok >> EGsub = c("1635_at"="25", "39329_at"="87", "40797_at"="102") >> utr = getSequence(id=EGsub, seqType="3utr", > + mart=ensembl, type="entrezgene") > CA ..... I cut out a lot of the sequence ... > GTGCCCTGCCTTGCACCTCCGCCTTATTTTCTGC 87 > V1 > 1 HTTP/1.1 200 OK > 2 Date: Thu, 28 May 2009 20:56:08 GMT > 3 Server: Apache/2.2.9 (Debian) mod_perl/2.0.4 Perl/v5.10.0 > 4 Connection: close > 5 Transfer-Encoding: chunked > 6 Content-Type: text/plain > Error in getBM(c(seqType, type), filters = type, values = id, mart = > mart, : > The query to the BioMart webservice returned an invalid result: the > number of columns in the result table does not equal the number of > attributes in the query. Please report this to the mailing list. >> sessionInfo() > R version 2.9.0 Patched (2009-05-28 r48678) > x86_64-unknown-linux-gnu > > locale: > LC_CTYPE > = > en_US > .UTF > -8 > ;LC_NUMERIC > = > C > ;LC_TIME > = > en_US > .UTF > -8 > ;LC_COLLATE > = > en_US > .UTF > -8 > ;LC_MONETARY > = > C > ;LC_MESSAGES > = > en_US > .UTF > -8 > ;LC_PAPER > = > en_US > .UTF > -8 > ;LC_NAME > = > C > ;LC_ADDRESS > =C;LC_TELEPHONE=C;LC_MEASUREMENT=en_US.UTF-8;LC_IDENTIFICATION=C > > attached base packages: > [1] stats graphics grDevices utils datasets methods base > > other attached packages: > [1] biomaRt_2.0.0 > > loaded via a namespace (and not attached): > [1] RCurl_0.95-1 tools_2.9.0 XML_2.3-0 > > > On May 28, 2009, at 5:01 AM, Wolfgang Huber wrote: > >> Hi >> >> just to warn all users of the development version of biomaRt, please >> wait a few days before updating your RCurl, the current devel >> versions of these two packages do not work together. We are sorting >> it out. >> >> An example for the error that is produced, with RCurl_0.97-2 and >> biomaRt_2.1.0, is shown below. With a previous version of RCurl, the >> problem should not arise. >> >> >> library("biomaRt") >> mart = useMart("ensembl") >> ensembl = useDataset("hsapiens_gene_ensembl", >> mart=mart) >> EGsub = c("1635_at"="25", "39329_at"="87", "40797_at"="102") >> utr = getSequence(id=EGsub, seqType="3utr", >> mart=ensembl, type="entrezgene") >> >> CAGCAGTCAGGGGTCAGGTGTCAGGCCCGTCGGAGCT... 25 >> CTGCAGCTTTTGCCTTGGTTCTTCCTAGTGCCTACAA... 102 >> TCCACCCCGCCCGGCCGCCCTCGTCTTGTGCGCCGTG... 87 >> TCCACCCCGCCCGGCCGCCCTCGTCTTGTGCGCCGTG... 87 >> V1 >> 1 HTTP/1.1 200 OK >> 2 Date: Thu, 28 May 2009 11:57:58 GMT >> 3 Server: Apache/2.2.9 (Debian) mod_perl/2.0.4 Perl/v5.10.0 >> 4 Connection: close >> 5 Transfer-Encoding: chunked >> 6 Content-Type: text/plain >> >> Errore in getBM(c(seqType, type), filters = type, values = id, mart >> = mart, : >> The query to the BioMart webservice returned an invalid result: the >> number of columns in the result table does not equal the number of >> attributes in the query. Please report this to the mailing list. >> >> >>> sessionInfo() >> R version 2.10.0 Under development (unstable) (2009-05-28 r48665) >> x86_64-unknown-linux-gnu >> >> locale: >> [1] LC_CTYPE=C LC_NUMERIC=C LC_TIME=C >> [4] LC_COLLATE=C LC_MONETARY=C LC_MESSAGES=it_IT.UTF-8 >> [7] LC_PAPER=C LC_NAME=C LC_ADDRESS=C >> [10] LC_TELEPHONE=C LC_MEASUREMENT=C >> LC_IDENTIFICATION=C >> >> attached base packages: >> [1] stats graphics grDevices datasets utils methods base >> >> other attached packages: >> [1] biomaRt_2.1.0 fortunes_1.3-6 >> >> loaded via a namespace (and not attached): >> [1] RCurl_0.97-2 XML_2.3-0 >>> >> >> >> -- >> >> Best wishes >> Wolfgang >> >> ------------------------------------------------ >> Wolfgang Huber, EMBL, http://www.ebi.ac.uk/huber >> >> _______________________________________________ >> Bioconductor mailing list >> Bioconductor at stat.math.ethz.ch >> https://stat.ethz.ch/mailman/listinfo/bioconductor >> Search the archives: http://news.gmane.org/gmane.science.biology.informatics.conductor > > _______________________________________________ > Bioconductor mailing list > Bioconductor at stat.math.ethz.ch > https://stat.ethz.ch/mailman/listinfo/bioconductor > Search the archives: http://news.gmane.org/gmane.science.biology.informatics.conductor > > _______________________________________________ > Bioconductor mailing list > Bioconductor at stat.math.ethz.ch > https://stat.ethz.ch/mailman/listinfo/bioconductor > Search the archives: http://news.gmane.org/gmane.science.biology.informatics.conductor