Hi, It is actually a bit simpler than Mark has suggested. biocLite("rat2302probe") will get the probe sequences used (at least as reported in late March - but they should not change) then you could ask Herve to build a BSgenome package for Rat, and use Biostrings to do the matching... or save the probes and use BLAT or any other string matcher (MAQ) best wishes Robert Mark Cowley wrote: > Hi Christoph, > I would recommend obtaining the sequences of the actual probes that make > up this probeset (from NetAffx), then align them to the latest genome > using BLAT, thereby you can convince yourself which mRNA that these > probes will be most likely to detect. > I find that aligning the probes often tells you far more information > than the affymetrix consensus sequence ever wi > Be very concerned if your probes start aligning all over the genome!ll. > > cheers, > Mark > > On 03/07/2008, at 3:47 AM, Marc Carlson wrote: > >> Christoph Preuss wrote: >>> Hi everyone, >>> >>> We analyzed a global exression microarray data set using gcrma for the >>> normalization step and limma for finding differentially expressed >>> genes. One of the most significant probesets (ProbeSetID annotation >>> "1375535_at") in terms of d.e is annotated as : >>> Probeset "1375535_at" >>> -Gene Symbol: Lpin1 >>> - Location: Chr 6 >>> >>> in the bioconductor package "rat2302" / "rat2302.db". >>> >>> We also looked at the Affymetrix web site, where the same probeset was >>> annoted as "Transcribed sequence" on chromosome X. >>> >>> Affymetrix Annotation RG 230 2.0 Chip: >>> -ProbeSetID: 1375535_at >>> -Target Sequence: >>> >>>> RAT230_2:1375535_AT >>>> >>> gaagttagagagctgtttccccactttacattttaaaatatgtatgccaggatntaatca >>> ttcctttaagtgtacacttcaaggagagatgtgccgaataagaaaatagctttctctagc >>> gtgaagggttttgcgtccgccgagttcttaaggtcttttttaagagctactgtgtatgag >>> tgtgtgtatgtgtgcgcatgcatgttcctgcgactagtcattcattcacatggtgatcag >>> acaacaatgggagctggttcgtctaccttatcttgtgggtcctggagttcaatctcagat >>> catcaggctgggcagcaagtgccttcaccctccgagccatcttgccatcccacagctgag >>> cgtctaatatgacattgccgatga >>> >>> Interestingly, the given target sequence for the probeset matches only >>> a mouse sequence and not even a rat mRNA (blastn search). >>> >>> The question is which annotation should we trust? >>> Is there any chance to validate the probeset annotation? >>> Many thanks in advance for any help. >>> >>> cheers, >>> >>> Christoph Preuss >>> >>> (Leibniz-Institute for Arteriosclerosis Research, University of >>> Muenster Germany ) >>> >>> _______________________________________________ >>> Bioconductor mailing list >>> Bioconductor at stat.math.ethz.ch >>> https://stat.ethz.ch/mailman/listinfo/bioconductor >>> Search the archives: >>> http://news.gmane.org/gmane.science.biology.informatics.conductor >>> >>> >> Hi Christoph, >> >> I can only really speak for the Bioconductor annotations which are >> generated from public sources along with an initial mapping of the >> probe or probeset to a public accession (usually this is a Genbank, >> Entrez ID or a related type of ID). In the case of "1375535_at", the >> probeset is an Affymetrix probeset and so we are ultimately at the >> mercy of Affymetrix to accurately tell us what this probeset is in >> this initial mapping, but after this we do the rest ourselves by using >> public sources. We map the probeset to ID information onto additional >> information gathered from public sources (primarily NCBI) to get the >> rest of the information in the package. The file that you get from >> Affymetrix may also have a lot of the same data as our packages, but >> unless they describe it somewhere, I don't think we actually know for >> certain where they collected all of their information from. The only >> information that we ever actually take from them is the initial >> mapping of their probeset onto a public accession. >> >> I dug up the latest Affymetrix mapping files that we used to generate >> this package and investigated. From the file that I have (which was >> collected in late March) the probeset you listed is indicated to be >> Lpin1, and also to be located on Chromosome 6 which agrees completely >> with the information that we gathered from NCBI and GoldenPath from >> this time. As of this morning, NCBI still lists this gene as being >> Lipin1 and being located on Chromosome 6. However, there is also a >> field right next to that in the Affymetrix file that is called >> "Alignments" which lists the X chromosome. But when I pull up an even >> more recent file from Affymetrix, then I see that they no longer list >> the location of this gene and have now replaced that value with a >> "---", they also no longer list the genes name or symbol. But they >> still list Chromosome "X" in the alignment field and have even >> assigned different accessions to this probeset. >> So the short answer is that Affymetrix has changed their mind about >> what they are claiming this probeset is measuring. >> >> >> I hope this helps you, >> >> >> Marc >> >> _______________________________________________ >> Bioconductor mailing list >> Bioconductor at stat.math.ethz.ch >> https://stat.ethz.ch/mailman/listinfo/bioconductor >> Search the archives: >> http://news.gmane.org/gmane.science.biology.informatics.conductor > > _______________________________________________ > Bioconductor mailing list > Bioconductor at stat.math.ethz.ch > https://stat.ethz.ch/mailman/listinfo/bioconductor > Search the archives: > http://news.gmane.org/gmane.science.biology.informatics.conductor > -- Robert Gentleman, PhD Program in Computational Biology Division of Public Health Sciences Fred Hutchinson Cancer Research Center 1100 Fairview Ave. N, M2-B876 PO Box 19024 Seattle, Washington 98109-1024 206-667-7700 rgentlem at fhcrc.org