Is there some reason for you not wanting to update your BioC distribution? It might even solve the problem you had with the matchprobes package... Cei Benoit Ballester wrote: > Hi, > > already tested - and doesn't seem to work - it seems that there is a > version issue. > > > library(gngnf1musaprobe) > Error: package 'matchprobes' 1.4.0 was found, but >= 1.8.1 is required > by 'gngnf1musaprobe' > > Would that explain why it doesn't work ? > Also I realized that I don't specify package="matchprobes" when I > load my file. > > filename<-system.file("extdata","gnGNF1Musa.probe.6tab") > > > doing so : > filename<-system.file("extdata","gnGNF1Musa.probe.6tab", > package="matchprobes") > and re-creating gngnf1musaprobe, gives me the same error than with cei > probe package. > > would that be the reason why something goes wrong ? > > Cheers, > > Ben > > Cei Abreu-Goodger wrote: >> Might I suggest, as a temporal solution, that you use the packages >> that I've previously built and posted on the bioC mailing list? >> >> http://article.gmane.org/gmane.science.biology.informatics.conducto r/13659 >> >> >> Cheers, >> >> Cei >> >> Benoit Ballester wrote: >>> James W. MacDonald wrote: >>> >>>> Hi Ben, >>>> >>>> Benoit Ballester wrote: >>>> >>>>> Hi, >>>>> >>>>> I am trying to use gcrma for the mouse GNF/Novartis data. >>>>> This dataset use a custom affy chip gnGNF1Musa. I got the CDF file >>>>> and probe file from GEO. >>>>> >>>>> >>>>> > library("gngnf1musacdf") >>>>> > library("gngnf1musaprobe") >>>>> > eset.gcrma<-gcrma(Data) >>>>> Adjusting for optical effect.......[more dots].....Done. >>>>> Computing affinitiesError: length(prlen) == 1 is not TRUE >>>>> >>>> This indicates that you have probes of more than one length (e.g., >>>> they are not all 25-mers). This might have to do with what you note >>>> below, that there is an extra column in your probe_tab file. >>>> However, there is error checking in makeProbePackage that is >>>> supposed to catch these sorts of things, so I am wondering how you >>>> were ever able to make the package in the first place. >>>> >>>> What do you get from >>>> >>>> head(as.data.frame(gngnf1musaprobe)) >>>> >>>> Does the probe sequence column actually contain probe sequences? If >>>> not, you will need to remove the extra column from your probe_tab >>>> file and re-run makeProbePackage. >>>> >>> >>> Hi, >>> >>> This is what I have done - I have *removed* the extra column to have >>> a tab file which looks like that : >>> >>> AFFX-BioB-5_at 429 502 123 TCGTCAGGTGCAGGTCAGCACGTTG Antisense >>> AFFX-BioB-5_at 430 502 132 GCAGGTCAGCACGTTGCTGTCGATT Antisense >>> AFFX-BioB-5_at 431 502 138 CAGCACGTTGCTGTCGATTAAGACC Antisense >>> AFFX-BioB-5_at 432 502 147 GCTGTCGATTAAGACCGGAGCTTGT Antisense >>> AFFX-BioB-5_at 433 502 165 AGCTTGTCCGGAAGATTGCAAATAC Antisense >>> AFFX-BioB-5_at 434 502 177 AGATTGCAAATACTGCCCGCAAACG Antisense >>> AFFX-BioB-5_at 435 502 183 CAAATACTGCCCGCAAACGTCGCGC Antisense >>> AFFX-BioB-5_at 436 502 246 TGAACAGGTGCTGGAGTCGGCGCGC Antisense >>> >>> exactly like in the HG-U95Av2_probe_tab file that is in >>> matrchprobes/extdata/ >>> >>> >>> >>> I rerun the makeProbePackage again >>> > library(matchprobes) >>> > filename<-system.file("extdata","gnGNF1Musa.probe.6tab") >>> > >>> > me<-"Benoit Ballester<benoit at="" ebi.ac.uk="">" >>> > species<-"Mus_musculus" >>> > >>> > makeProbePackage("gnGNF1Musa", datafile = filename, maintainer = >>> me, species = species, version = "0.0.1",force = TRUE) >>> Importing the data. >>> Creating package in ./gngnf1musaprobe >>> Existing ./gngnf1musaprobe was removed. >>> Writing the data. >>> Checking the package. >>> Building the package. >>> [1] "gngnf1musaprobe" >>> Warning message: >>> file("") only supports open = "w+" and open = "w+b": using the former >>> >>> >>> >>> Then I reinstall gngnf1musaprobe: >>> >>> benoit at xxxx > R CMD INSTALL gngnf1musaprobe >>> * Installing *source* package 'gngnf1musaprobe' ... >>> ** R >>> ** data >>> ** help >>> >>> Building/Updating help pages for package 'gngnf1musaprobe' >>> Formats: text html latex example >>> gngnf1musaprobe text html latex example >>> ** building package indices ... >>> * DONE (gngnf1musaprobe) >>> >>> >>> >>> If I look at : >>> >>> > library(gngnf1musaprobe) >>> > head(as.data.frame(gngnf1musaprobe)) >>> [1] sequence x >>> [3] y Probe.Set.Name >>> [5] Probe.Interrogation.Position Target.Strandedness >>> <0 rows> (or 0-length row.names) >>> >>> > gngnf1musaprobe >>> Object of class probetable data.frame with 0 rows and 6 columns >>> > gngnf1musaprobe[1,1] >>> [1] NA >>> >>> >>> So I still get nothing. >>> Am I doing something silly when I create gngnf1musaprobe or there >>> something wrong in the code ? >>> >>> >>> I have tried with the HG-U95Av2_probe_tab file from >>> matchprobes/extdata, and recreated the probe env >>> >>> > library(matchprobes) >>> > filename<-system.file("extdata"," HG-U95Av2_probe_tab") >>> > >>> > me<-"Benoit Ballester<benoit at="" ebi.ac.uk="">" >>> > species<-"Homo_sapiens" >>> > makeProbePackage("HG-U95Av2", datafile = filename, maintainer = >>> me, species = species, version = "0.0.1",force = TRUE) >>> Importing the data. >>> Creating package in ./hgu95av2probe >>> Writing the data. >>> Checking the package. >>> Building the package. >>> [1] "hgu95av2probe" >>> Warning message: >>> file("") only supports open = "w+" and open = "w+b": using the former >>> >>> >>> then : >>> R CMD INSTALL hgu95av2probe >>> >>> back in R >>> > library(hgu95av2probe) >>> > hgu95av2probe >>> Object of class probetable data.frame with 0 rows and 6 columns. >>> > hgu95av2probe[1,1] >>> [1] NA >>> >>> >>> Wtill nothing with the examples. Looks like my file is not the >>> problem, and the problem is somewhere else. >>> Any ideas ? >>> >>> >>> Cheers, >>> >>> Ben >>> >>> >> >> >> > -- The Wellcome Trust Sanger Institute is operated by Genome Research Limited, a charity registered in England with number 1021457 and a company registered in England with number 2742969, whose registered office is 215 Euston Road, London, NW1 2BE.