Hello community, I am trying to run the r3cseq pipeline but errors are occuring in a specific situation. I did two tries, starting from a fastq file with a sequence of 50 bp, mapping to my genome(hg19), creating bams files and running the r3cseq pipeline. In that case I got results all the way to the end, plots etc. Then I did a second try, where I wanted to trim my sequence by 14 bp(so the new length is 36 bp),I did the mapping again, created bam files but then in the r3cseq pipeline I started getiing errors.

This is the code I used:

expFile <- "rawreads.bam"

my3Cseq.obj<-new("r3Cseq",organismName='hg19',isControlInvolved=F,alignedReadsBamExpFile=expFile,
                 viewpoint_chromosome='chr4',viewpoint_primer_forward='TTGCTTCTCATCTGTCGATC',
                 viewpoint_primer_reverse='CAGAAAGGTGAACCGAGAG',expLabel="label",
                 restrictionEnzyme='DpnII')

getRawReads(my3Cseq.obj)

getReadCountPerRestrictionFragment(my3Cseq.obj)

calculateRPM(my3Cseq.obj)

getInteractions(my3Cseq.obj)

expResults<- expInteractionRegions(my3Cseq.obj)

I am getting the error in the calculateRPM step:

Error in calculateRPM(my3Cseq.obj) : 
  No reads count per regions found in the r3Cseq object.

Is there a specific limit to the sequence length I can use?

I am also attaching part of my object's output:

Slot "expLibrarySize":
[1] 4794

Slot "contrLibrarySize":
integer(0)

Slot "expReadLength":
[1] 36

Slot "contrReadLength":
integer(0)

Slot "expRawData":
GRanges object with 4794 ranges and 0 metadata columns:
         seqnames              ranges strand
            <Rle>           <IRanges>  <Rle>
     [1]     chr4 121738162-121738197      +
     [2]     chr4 121738162-121738197      +
     [3]     chr4 121738162-121738197      +
     [4]     chr4 121738162-121738197      +
     [5]     chr4 121738162-121738197      +
     ...      ...                 ...    ...
  [4790]     chr4 121738162-121738197      +
  [4791]     chr4 121738162-121738197      +
  [4792]     chr4 121738162-121738197      +
  [4793]     chr4 121738162-121738197      +
  [4794]     chr4 121738162-121738197      +
  -------
  seqinfo: 1 sequence from an unspecified genome; no seqlengths

Slot "contrRawData":
GRanges object with 0 ranges and 0 metadata columns:
   seqnames    ranges strand
      <Rle> <IRanges>  <Rle>
  -------
  seqinfo: no sequences

Slot "organismName":
[1] "hg19"

Slot "restrictionEnzyme":
[1] "DpnII"

Slot "viewpoint_chromosome":
[1] "chr4"

Slot "viewpoint_primer_forward":
[1] "ATAAAGTCATGTTCGTGATC"

Slot "viewpoint_primer_reverse":
[1] "CATGCATACTTTCATGCTTC"

Slot "expReadCount":
GRanges object with 0 ranges and 1 metadata column:
   seqnames    ranges strand |    nReads
      <Rle> <IRanges>  <Rle> | <integer>
  -------
  seqinfo: 24 sequences from an unspecified genome; no seqlengths

Slot "contrReadCount":
GRanges object with 0 ranges and 0 metadata columns:
   seqnames    ranges strand
      <Rle> <IRanges>  <Rle>
  -------
  seqinfo: no sequences

Slot "expRPM":
GRanges object with 0 ranges and 0 metadata columns:
   seqnames    ranges strand
      <Rle> <IRanges>  <Rle>
  -------
  seqinfo: no sequences

Slot "contrRPM":
GRanges object with 0 ranges and 0 metadata columns:
   seqnames    ranges strand
      <Rle> <IRanges>  <Rle>
  -------
  seqinfo: no sequences

Slot "expInteractionRegions":
GRanges object with 0 ranges and 0 metadata columns:
   seqnames    ranges strand
      <Rle> <IRanges>  <Rle>
  -------
  seqinfo: no sequences

Slot "contrInteractionRegions":
GRanges object with 0 ranges and 0 metadata columns:
   seqnames    ranges strand
      <Rle> <IRanges>  <Rle>
  -------
  seqinfo: no sequences

and my session info:

R version 3.6.3 (2020-02-29)
Platform: x86_64-pc-linux-gnu (64-bit)
Running under: Ubuntu 18.04.4 LTS

Matrix products: default
BLAS:   /usr/lib/x86_64-linux-gnu/blas/libblas.so.3.7.1
LAPACK: /usr/lib/x86_64-linux-gnu/lapack/liblapack.so.3.7.1

Random number generation:
 RNG:     Mersenne-Twister 
 Normal:  Inversion 
 Sample:  Rounding 

locale:
 [1] LC_CTYPE=en_US.UTF-8       LC_NUMERIC=C               LC_TIME=es_ES.UTF-8        LC_COLLATE=en_US.UTF-8    
 [5] LC_MONETARY=es_ES.UTF-8    LC_MESSAGES=en_US.UTF-8    LC_PAPER=es_ES.UTF-8       LC_NAME=C                 
 [9] LC_ADDRESS=C               LC_TELEPHONE=C             LC_MEASUREMENT=es_ES.UTF-8 LC_IDENTIFICATION=C       

attached base packages:
 [1] splines   parallel  stats4    stats     graphics  grDevices utils     datasets  methods   base     

other attached packages:
 [1] BSgenome.Hsapiens.UCSC.hg19.masked_1.3.99 BSgenome.Hsapiens.UCSC.hg19_1.4.0        
 [3] BSgenome_1.52.0                           r3Cseq_1.30.0                            
 [5] qvalue_2.16.0                             VGAM_1.1-2                               
 [7] rtracklayer_1.44.4                        Rsamtools_2.0.3                          
 [9] Biostrings_2.52.0                         XVector_0.24.0                           
[11] GenomicRanges_1.36.1                      GenomeInfoDb_1.20.0                      
[13] IRanges_2.18.3                            S4Vectors_0.22.1                         
[15] BiocGenerics_0.30.0                      

loaded via a namespace (and not attached):
 [1] Rcpp_1.0.4.6                lattice_0.20-41             assertthat_0.2.1            digest_0.6.25              
 [5] R6_2.4.1                    plyr_1.8.6                  chron_2.3-55                RSQLite_2.2.0              
 [9] sqldf_0.4-11                ggplot2_3.3.0               pillar_1.4.3                zlibbioc_1.30.0            
[13] rlang_0.4.5                 rstudioapi_0.11             data.table_1.12.8           blob_1.2.1                 
[17] rpart_4.1-15                Matrix_1.2-18               gsubfn_0.7                  proto_1.0.0                
[21] BiocParallel_1.18.1         stringr_1.4.0               RCurl_1.98-1.2              bit_1.1-15.2               
[25] munsell_0.5.0               DelayedArray_0.10.0         compiler_3.6.3              pkgconfig_2.0.3            
[29] tidyselect_1.0.0            SummarizedExperiment_1.14.1 tibble_3.0.1                GenomeInfoDbData_1.2.1     
[33] matrixStats_0.56.0          XML_3.99-0.3                crayon_1.3.4                dplyr_0.8.5                
[37] GenomicAlignments_1.20.1    bitops_1.0-6                grid_3.6.3                  gtable_0.3.0               
[41] lifecycle_0.2.0             DBI_1.1.0                   magrittr_1.5                scales_1.1.0               
[45] stringi_1.4.6               reshape2_1.4.4              ellipsis_0.3.0              vctrs_0.2.4                
[49] RColorBrewer_1.1-2          tools_3.6.3                 bit64_0.9-7                 Biobase_2.44.0             
[53] glue_1.4.0                  purrr_0.3.4                 yaml_2.2.1                  colorspace_1.4-1           
[57] memoise_1.1.0

Many thanks in advance!