Dear All, I have a problem here that not sure can be easily addressed by using any bioconductor packages. I have a siRNA sequence with 19 nt, I want to search the guide sequence against human genome to generate the following outputs: 1. Any genes that are mapped to the sequence with max of for example 5 mis-matches; 2. Genome coordinate of the matches

Many Thanks! Steve

I wrote a wrapper around Biostrings::matchPattern which finds all occurrences of a DNA string (optionally with mismatches) in a given BSgenome. It returns a GRanges object with all match locations separated by strand (top/bottom strand). See on Github.

In your case it could be with your siRNA sequence:

FindSequenceOccurrence(Sequence = "AGCTAGCTAGTTGTGTACAGT",  
                       MaxMismatches = 5,
                       BSGenome = BSgenome.Hsapiens.UCSC.hg38)

Once you have the coordinates you can simply intersect them with any gene annotation.

Sounds like something you could do with Biostrings, particularly the matchPDict function. The first set of examples for that function seem to be pretty close to what you want to do, so I'd start there.