Hello everyone,

i do some work with LbCpf1 for my bachelor thesis and try to find gRNAs with an OffTargetAnalysis in the package CRISPRseek. I get some results, but i don't get a score or a validation of the gRNA's.

My Code:

library(CRISPRseek)
library(myBSgenome)


outputDir <- myWd
inputFilePath <- my.fasta
REpatternFile <- system.file('extdata', 'NEBenzymes.fa', package = 'CRISPRseek')




results <- offTargetAnalysis(inputFilePath, findgRNAsWithREcutOnly = FALSE, findgRNAs = TRUE,
                             REpatternFile = REpatternFile,findPairedgRNAOnly = FALSE,
                             annotatePaired = TRUE, enable.multicore = FALSE, n.cores.max = 1, min.gap = 0, 
                             max.gap = 20, 
                             gRNA.name.prefix = "", PAM.size = 4, gRNA.size = 23, PAM = "TTTN", 
                             BSgenomeName = myBSgenome, chromToSearch = "all",
                             max.mismatch = 3, PAM.pattern = "^TTTV", allowed.mismatch.PAM = 1, 
                             annotateExon = FALSE,
                             weights = c(0, 0, 0, 0, 0, 0.014, 0, 0, 0.395, 0.317, 0, 0.389, 0.079, 0.445, 
                             0.508, 0.613,
                             0.851, 0.732, 0.828, 0.615, 
                             0.804, 0.685, 0.583), 
                             baseBeforegRNA = 22, baseAfterPAM = 28, subPAM.position = c(1, 2), 
                             PAM.location = "5prime",  
                             outputDir = outputDir, 
                             overwrite = TRUE)

For this Code i get a summary of the gRNAs, paired gRNAs and the RECutDetails. The following Warning occured:

Warning message:

In searchHits2(gRNAs = gRNAs, PAM = PAM, PAM.pattern = PAM.pattern,  :
  No matching found, please check your input sequence, and make
            sure you are using the right genome. You can also alter your 
            search criteria such as increasing max.mismatch!

I don' t have the Target-Sequence in my BSGenome file for now, so i think I can ignore this Warning.

Because i want to have a score for the gRNAs I tried the following code:

rm(list = ls())
setwd("C:/Users/Nils/Documents/Uni/Unterlagen/6.Semester/CRISPRseek")


library(CRISPRseek)
library(myBSgenome)


outputDir <- myWD
inputFilePath <- my.fasta
REpatternFile <- system.file('extdata', 'NEBenzymes.fa', package = 'CRISPRseek')
featureWeightMatrixFile <- system.file("extdata", "DoenchNBT2014.csv", package = "CRISPRseek")
featureWeightMatrix <- read.csv(featureWeightMatrixFile, header=TRUE)





results <- offTargetAnalysis(inputFilePath, findgRNAsWithREcutOnly = FALSE, findgRNAs = TRUE,
                             REpatternFile = REpatternFile,findPairedgRNAOnly = FALSE,
                             annotatePaired = TRUE, enable.multicore = FALSE, n.cores.max = 1, min.gap = 0, 
                             max.gap = 20, 
                             gRNA.name.prefix = "", PAM.size = 4, gRNA.size = 23, PAM = "TTTN", 
                             BSgenomeName = myBSgenome, chromToSearch = "all",
                             max.mismatch = 3, PAM.pattern = "^TTTV", allowed.mismatch.PAM = 1, 
                             annotateExon = FALSE,
                             weights = c(0, 0, 0, 0, 0, 0.014, 0, 0, 0.395, 0.317, 0, 0.389, 
                             0.079, 0.445, 0.508,
                             0.613, 0.851, 0.732, 0.828, 0.615, 
                             0.804, 0.685, 0.583), 
                             baseBeforegRNA = 22, baseAfterPAM = 28, subPAM.position = c(1, 2), 
                             PAM.location = "5prime",
                             featureWeightMatrix, useScore = TRUE, useEfficacyFromInputSeq = FALSE, 
                             outputUniqueREs = TRUE,
                             foldgRNAs = FALSE,
                             gRNA.backbone="GUUUUAGAGCUAGAAAUAGCAAGUUAAA
                             AUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUU", temperature = 37, 
                             scoring.method = c("Hsu-Zhang", "CFDscore"), 
                             subPAM.activity = hash( 
                               AA =0, 
                               AC = 0, 
                               AG = 0.259259259, 
                               AT = 0,
                               CA = 0, 
                               CC = 0, 
                               CG = 0.107142857, 
                               CT = 0, 
                               GA = 0.069444444, 
                               GC = 0.022222222, 
                               GG = 1, 
                               GT = 0.016129032, 
                               TA = 0, 
                               TC = 0, 
                               TG = 0.038961039, 
                               TT = 0),
                             outputDir = outputDir, overwrite = TRUE)

I get the following ERROR:

Error in findgRNAs(inputFilePath, findPairedgRNAOnly = findPairedgRNAOnly,  : 
  format needs to be either fasta or fastq !
In addition: Warning message:
In if (format == "bed") { :
  the condition has length > 1 and only the first element will be used

I checked the Code and it works except of "featureweightmatrix".

I'm sorry for my bad englisch and bad knowledge in Bioinformatics. I would appreciate your help and hope you can help me to get a score or validation for my gRNAs.

Best regards,

Nils

Nils,

Please try to set baseBeforegRNA = 8, baseAfterPAM = 23 for Cpf1. If your input sequence is not expected to be present in the genome, please set useEfficacyFromInputSeq = TRUE. In addition, the function expects featureWeightMatrix to be a file path. To use DoenchNBT2014.csv included in the package, please set the parameter as the following. featureWeightMatrix = featureWeightMatrixFile = system.file("extdata", "DoenchNBT2014.csv", package = "CRISPRseek").

It will be more accurate if you input a Cpf1-specific feature weight matrix. I am currently trying to incorporate the prediction algorithm from Kim et al. Nature Biotechnology volume 36, pages 239–241 2018.

Best,

Julie