Maybe I am doing something wrong but when combining U95A and U95Av2 files using function combineAffyBatch() it seems that 197 probe sets from U95A and from U95Av2 are deleted although there are only 51 different probe sets. Furthermore, it seems that probe sets which are available on both U95A and U95Av2 are deleted and not the different probe sets. Here is my code, which supports my statements: # call libraries >library(matchprobes) >library(affy) >library(hgu95acdf) >library(hgu95aprobe) >library(hgu95av2cdf) >library(hgu95av2probe) # load CEL files from folders HG-U95A and HG-U95Av2 >x95A <- ReadAffy(celfile.path="HG-U95A") >x95Av2 <- ReadAffy(celfile.path="HG-U95Av2") # combine data >res <- combineAffyBatch(list(x95A,x95Av2), c("hgu95aprobe","hgu95av2probe"), newcdf="comb95") >comb95 <- res$cdf # rma normalization for combined data >dat.rma <- rma(res$dat) # rma normalization for U95A and U95Av2 separately >x95A.rma <- rma(x95A) >x95Av2.rma <- rma(x95Av2) # store log2 of expression data as matrix, sort for AffyIDs, and export >dat.r2 <- exprs(dat.rma) >d <- dimnames(dat.r2)[[1]] >dat.r2 <- dat.r2[order(d),] >write.table(dat.r2,file="dat_rma.txt",sep="\t",quote=F,col.names=NA) >x95A.r2 <- exprs(x95A.rma) >d <- dimnames(x95A.r2)[[1]] >x95A.r2 <- x95A.r2[order(d),] >write.table(x95A.r2,file="x95A_rma.txt",sep="\t",quote=F,col.names=NA ) >x95Av2.r2 <- exprs(x95Av2.rma) >d <- dimnames(x95Av2.r2)[[1]] >x95Av2.r2 <- x95Av2.r2[order(d),] >write.table(x95Av2.r2,file="x95Av2_rma.txt",sep="\t",quote=F,col.name s=NA) The following 25 probe sets are on U95Av2 but NOT on U95A: >unlist(setdiff(dimnames(x95Av2.r2)[[1]],dimnames(x95A.r2)[[1]])) [1] "160020_at" "160021_r_at" "160022_at" "160023_at" "160024_at" [6] "160025_at" "160026_at" "160027_s_at" "160028_s_at" "160029_at" [11] "160030_at" "160031_at" "160032_at" "160033_s_at" "160034_s_at" [16] "160035_at" "160036_at" "160037_at" "160038_s_at" "160039_at" [21] "160040_at" "160041_at" "160042_s_at" "160043_at" "160044_g_at" The following 26 probe sets are on U95A but NOT on U95Av2: >unlist(setdiff(dimnames(x95A.r2)[[1]],dimnames(x95Av2.r2)[[1]])) [1] "119_at" "1215_at" "1216_at" "124_i_at" "125_r_at" "127_at" [7] "1301_s_at" "1302_s_at" "132_at" "1429_at" "1502_s_at" "1829_at" [13] "1864_at" "1889_s_at" "1982_s_at" "36969_at" "383_at" "397_at" [19] "412_s_at" "426_at" "439_at" "787_at" "788_s_at" "972_s_at" [25] "985_s_at" "997_at" This is corrrect, since I checked this also manually! Thus alltogether 51 probe sets which are not on both chips, should be eliminated by function combineAffyBatch(). Is this correct? However, these are the differences between the combined table and U95Av2: >unlist(setdiff(dimnames(x95Av2.r2)[[1]],dimnames(dat.r2)[[1]])) [1] "1142_at" "1143_s_at" "1144_at" "1145_g_at" "1146_at" [6] "1147_at" "1148_s_at" "1149_at" "1150_at" "1151_at" [11] "1162_g_at" "1163_at" "1164_at" "1170_at" "1171_s_at" [16] "1172_at" "1173_g_at" "1174_at" "1175_s_at" "1176_at" [21] "1177_at" "1178_at" "1179_at" "1180_g_at" "1181_at" [26] "1278_at" "1279_s_at" "1280_i_at" "1281_f_at" "1282_s_at" [31] "1283_at" "1284_at" "1285_at" "1286_s_at" "1428_at" [36] "1513_at" "1514_g_at" "1515_at" "1516_g_at" "160020_at" [41] "160021_r_at" "160022_at" "160023_at" "160024_at" "160025_at" [46] "160026_at" "160027_s_at" "160028_s_at" "160029_at" "160030_at" [51] "160031_at" "160032_at" "160033_s_at" "160034_s_at" "160035_at" [56] "160036_at" "160037_at" "160038_s_at" "160039_at" "160040_at" [61] "160041_at" "160042_s_at" "160043_at" "160044_g_at" "1608_at" [66] "1609_g_at" "1623_s_at" "1624_at" "1625_at" "1626_at" [71] "1627_at" "1628_at" "1629_s_at" "1630_s_at" "1631_at" [76] "1632_at" "1661_i_at" "1662_r_at" "1663_at" "1664_at" [81] "1665_s_at" "1725_s_at" "1726_at" "1743_s_at" "1744_at" [86] "1745_at" "1746_s_at" "1790_s_at" "1812_s_at" "1813_at" [91] "1818_at" "1819_at" "1820_g_at" "1821_at" "1822_at" [96] "1823_g_at" "1837_at" "1838_g_at" "1839_at" "1840_g_at" [101] "1841_s_at" "1842_at" "1843_at" "1876_at" "1877_g_at" [106] "1881_at" "1882_g_at" "1883_s_at" "1892_s_at" "1893_s_at" [111] "1894_f_at" "1903_at" "1905_s_at" "1906_at" "1921_at" [116] "1922_g_at" "1936_s_at" "1937_at" "292_s_at" "293_at" [121] "294_s_at" "295_s_at" "296_at" "297_g_at" "298_at" [126] "299_i_at" "300_f_at" "301_at" "302_at" "303_at" [131] "304_at" "305_g_at" "311_s_at" "312_s_at" "313_at" [136] "323_at" "324_f_at" "325_s_at" "326_i_at" "327_f_at" [141] "328_at" "329_s_at" "330_s_at" "331_at" "332_at" [146] "333_s_at" "334_s_at" "335_r_at" "693_g_at" "694_at" [151] "695_at" "696_at" "697_f_at" "698_f_at" "699_s_at" [156] "700_s_at" "701_s_at" "702_f_at" "703_at" "704_at" [161] "705_at" "706_at" "707_s_at" "711_at" "712_s_at" [166] "713_at" "714_at" "723_s_at" "724_at" "725_i_at" [171] "726_f_at" "727_at" "728_at" "729_i_at" "730_r_at" [176] "731_f_at" "732_f_at" "733_at" "734_at" "735_s_at" [181] "918_at" "919_at" "920_at" "921_s_at" "936_s_at" [186] "937_at" "938_at" "939_at" "952_at" "953_g_at" [191] "954_s_at" "955_at" "956_at" "957_at" "958_s_at" [196] "959_at" "960_g_at" and these are the differences between the combined table and U95A: >unlist(setdiff(dimnames(x95A.r2)[[1]],dimnames(dat.r2)[[1]])) [1] "1142_at" "1143_s_at" "1144_at" "1145_g_at" "1146_at" "1147_at" [7] "1148_s_at" "1149_at" "1150_at" "1151_at" "1162_g_at" "1163_at" [13] "1164_at" "1170_at" "1171_s_at" "1172_at" "1173_g_at" "1174_at" [19] "1175_s_at" "1176_at" "1177_at" "1178_at" "1179_at" "1180_g_at" [25] "1181_at" "119_at" "1215_at" "1216_at" "124_i_at" "125_r_at" [31] "1278_at" "1279_s_at" "127_at" "1280_i_at" "1281_f_at" "1282_s_at" [37] "1283_at" "1284_at" "1285_at" "1286_s_at" "1301_s_at" "1302_s_at" [43] "132_at" "1428_at" "1429_at" "1502_s_at" "1513_at" "1514_g_at" [49] "1515_at" "1516_g_at" "1608_at" "1609_g_at" "1623_s_at" "1624_at" [55] "1625_at" "1626_at" "1627_at" "1628_at" "1629_s_at" "1630_s_at" [61] "1631_at" "1632_at" "1661_i_at" "1662_r_at" "1663_at" "1664_at" [67] "1665_s_at" "1725_s_at" "1726_at" "1743_s_at" "1744_at" "1745_at" [73] "1746_s_at" "1790_s_at" "1812_s_at" "1813_at" "1818_at" "1819_at" [79] "1820_g_at" "1821_at" "1822_at" "1823_g_at" "1829_at" "1837_at" [85] "1838_g_at" "1839_at" "1840_g_at" "1841_s_at" "1842_at" "1843_at" [91] "1864_at" "1876_at" "1877_g_at" "1881_at" "1882_g_at" "1883_s_at" [97] "1889_s_at" "1892_s_at" "1893_s_at" "1894_f_at" "1903_at" "1905_s_at" [103] "1906_at" "1921_at" "1922_g_at" "1936_s_at" "1937_at" "1982_s_at" [109] "292_s_at" "293_at" "294_s_at" "295_s_at" "296_at" "297_g_at" [115] "298_at" "299_i_at" "300_f_at" "301_at" "302_at" "303_at" [121] "304_at" "305_g_at" "311_s_at" "312_s_at" "313_at" "323_at" [127] "324_f_at" "325_s_at" "326_i_at" "327_f_at" "328_at" "329_s_at" [133] "330_s_at" "331_at" "332_at" "333_s_at" "334_s_at" "335_r_at" [139] "36969_at" "383_at" "397_at" "426_at" "439_at" "693_g_at" [145] "694_at" "695_at" "696_at" "697_f_at" "698_f_at" "699_s_at" [151] "700_s_at" "701_s_at" "702_f_at" "703_at" "704_at" "705_at" [157] "706_at" "707_s_at" "711_at" "712_s_at" "713_at" "714_at" [163] "723_s_at" "724_at" "725_i_at" "726_f_at" "727_at" "728_at" [169] "729_i_at" "730_r_at" "731_f_at" "732_f_at" "733_at" "734_at" [175] "735_s_at" "787_at" "788_s_at" "918_at" "919_at" "920_at" [181] "921_s_at" "936_s_at" "937_at" "938_at" "939_at" "952_at" [187] "953_g_at" "954_s_at" "955_at" "956_at" "957_at" "958_s_at" [193] "959_at" "960_g_at" "972_s_at" "985_s_at" "997_at" Can anybody tell me if there is a mistake in my code or why function combineAffyBatch() deletes the wrong probe sets? Best regards Christian ============================================== Christian Stratowa, PhD Boehringer Ingelheim Austria Dept NCE Lead Discovery - Bioinformatics Dr. Boehringergasse 5-11 A-1121 Vienna, Austria Tel.: ++43-1-80105-2470 Fax: ++43-1-80105-2782 email: christian.stratowa at vie.boehringer-ingelheim.com

Sorowly, until now I did not receive an answer to my question, so here is some more information: The main problem is that combineAffyBatch() adds probe set "412_s_at" to the list of common probe sets on U95A and U95Av2 although this probe set does NOT exist on U95Av2 but was replaced by probe set "160033_s_at". Analogously, other probe sets were replaced on U95Av2 too, but are not listed as common probe sets, e.g. "1829_at" is replaced by "160020_s_at". For this reason I was not able to subset the mas5 expression values for U95A and U95Av2 to the common probe sets. So why is probe set "412_s_at" added to the list of common probe sets but e.g. "1829_at" not, although both probe sets are replaced by oligos with the same (x,y)-coordinates but with different oligonucleotide sequences? Here is the addition to the code below to show these issues: # setdiff as vectors >a21 <- unlist(setdiff(dimnames(x95Av2.r2)[[1]],dimnames(x95A.r2)[[1]])) >a12 <- unlist(setdiff(dimnames(x95A.r2)[[1]],dimnames(x95Av2.r2)[[1]])) >a2 <- unlist(setdiff(dimnames(x95Av2.r2)[[1]],dimnames(dat.r2)[[1]])) >a1 <- unlist(setdiff(dimnames(x95A.r2)[[1]],dimnames(dat.r2)[[1]])) >setdiff(a1,a2) [1] "119_at" "1215_at" "1216_at" "124_i_at" "125_r_at" "127_at" [7] "1301_s_at" "1302_s_at" "132_at" "1429_at" "1502_s_at" "1829_at" [13] "1864_at" "1889_s_at" "1982_s_at" "36969_at" "383_at" "397_at" [19] "426_at" "439_at" "787_at" "788_s_at" "972_s_at" "985_s_at" [25] "997_at" >setdiff(a2,a1) [1] "160020_at" "160021_r_at" "160022_at" "160023_at" "160024_at" [6] "160025_at" "160026_at" "160027_s_at" "160028_s_at" "160029_at" [11] "160030_at" "160031_at" "160032_at" "160033_s_at" "160034_s_at" [16] "160035_at" "160036_at" "160037_at" "160038_s_at" "160039_at" [21] "160040_at" "160041_at" "160042_s_at" "160043_at" "160044_g_at" # Problem: probeset 412_s_at does NOT exist on U95Av2 and thus should not be listed on combined probe set! >setdiff(a21, setdiff(a2,a1)) character(0) >setdiff(a12, setdiff(a1,a2)) [1] "412_s_at" Here are the informations from the respective probe.tab files: #HG-U95A_probe.tab 412_s_at 286 579 1795 AGCCACGGGCGTCAGAGAGACCCGG Antisense 412_s_at 494 633 1798 CACGGGCGTCAGAGAGACCCGGGAA Antisense 412_s_at 446 145 1807 CAGAGAGACCCGGGAAGGAAGGCTC Antisense 412_s_at 77 573 1810 AGAGACCCGGGAAGGAAGGCTCTCG Antisense 412_s_at 202 259 1841 GGAGCCAGGACACCTGCTCTCCGGC Antisense 412_s_at 141 403 1842 GAGCCAGGACACCTGCTCTCCGGCG Antisense 412_s_at 302 119 1846 CAGGACACCTGCTCTCCGGCGCAGA Antisense 412_s_at 354 285 1854 CTGCTCTCCGGCGCAGACAGCGGGG Antisense 412_s_at 133 489 1855 TGCTCTCCGGCGCAGACAGCGGGGC Antisense 412_s_at 134 489 1856 GCTCTCCGGCGCAGACAGCGGGGCC Antisense 412_s_at 206 383 1858 TCTCCGGCGCAGACAGCGGGGCCCA Antisense 412_s_at 206 385 1859 CTCCGGCGCAGACAGCGGGGCCCAG Antisense 412_s_at 192 237 1864 GCGCAGACAGCGGGGCCCAGCGCTC Antisense 412_s_at 191 237 1865 CGCAGACAGCGGGGCCCAGCGCTCT Antisense 412_s_at 227 191 1868 AGACAGCGGGGCCCAGCGCTCTCCT Antisense 412_s_at 364 57 1870 ACAGCGGGGCCCAGCGCTCTCCTGG Antisense #HG-U95Av2_probe.tab 160033_s_at 1 364 57 1504 GTGCTCCAGGAAGATATAGACATTG Antisense 160033_s_at 2 302 119 1533 GGTACAGTCAGAAGGACAGGACAAT Antisense 160033_s_at 3 446 145 1534 GTACAGTCAGAAGGACAGGACAATG Antisense 160033_s_at 4 227 191 1568 ATTCTGGGGACACAGAGGATGAGCT Antisense 160033_s_at 5 191 237 1648 GGGGAAGACCCGTATGCAGGCTCCA Antisense 160033_s_at 6 192 237 1700 ACCAGGAGCCTCCTGATCTGCCAGT Antisense 160033_s_at 7 202 259 1718 TGCCAGTCCCTGAGCTCCCAGATTT Antisense 160033_s_at 8 354 285 1752 CAAGCACTTCTTTCTTTACGGGGAG Antisense 160033_s_at 9 206 383 1787 ACGAGCGGCGGAAACTCATCCGATA Antisense 160033_s_at 10 206 385 1797 GAAACTCATCCGATACGTCACAGCC Antisense 160033_s_at 11 141 403 1901 AGGAGGCCCTGATGGACAACCCCTC Antisense 160033_s_at 12 133 489 1926 CCTGGCATTCGTTCGTCCCCGATGG Antisense 160033_s_at 13 134 489 1952 TCTACAGTTGCAATGAGAAGCAGAA Antisense 160033_s_at 14 77 573 1969 AAGCAGAAGTTACTTCCTCACCAGC Antisense 160033_s_at 15 286 579 1980 ACTTCCTCACCAGCTCTATGGGGTG Antisense 160033_s_at 16 494 633 2006 TGCCGCAAGCCTGAAGTATGTGCTA Antisense P.S.: Looking at the Affymetrix "xx_annot.cvs" and "xx_probe.tab" files I realized that the oligo sequence is missing in the probe.tab file for all probe-sets which are annotated as "Sequence Source" = TIGR! It is not clear while the TIGR sequences are not listed in the probe.tab files. However, this explains why function combineAffyBatch() deletes 197 probe sets and not only the 51 different probe sets. Best regards Christian ============================================== Christian Stratowa, PhD Boehringer Ingelheim Austria Dept NCE Lead Discovery - Bioinformatics Dr. Boehringergasse 5-11 A-1121 Vienna, Austria Tel.: ++43-1-80105-2470 Fax: ++43-1-80105-2782 email: christian.stratowa at vie.boehringer-ingelheim.com Maybe I am doing something wrong but when combining U95A and U95Av2 files using function combineAffyBatch() it seems that 197 probe sets from U95A and from U95Av2 are deleted although there are only 51 different probe sets. Furthermore, it seems that probe sets which are available on both U95A and U95Av2 are deleted and not the different probe sets. Here is my code, which supports my statements: # call libraries >library(matchprobes) >library(affy) >library(hgu95acdf) >library(hgu95aprobe) >library(hgu95av2cdf) >library(hgu95av2probe) # load CEL files from folders HG-U95A and HG-U95Av2 >x95A <- ReadAffy(celfile.path="HG-U95A") >x95Av2 <- ReadAffy(celfile.path="HG-U95Av2") # combine data >res <- combineAffyBatch(list(x95A,x95Av2), c("hgu95aprobe","hgu95av2probe"), newcdf="comb95") >comb95 <- res$cdf # rma normalization for combined data >dat.rma <- rma(res$dat) # rma normalization for U95A and U95Av2 separately >x95A.rma <- rma(x95A) >x95Av2.rma <- rma(x95Av2) # store log2 of expression data as matrix, sort for AffyIDs, and export >dat.r2 <- exprs(dat.rma) >d <- dimnames(dat.r2)[[1]] >dat.r2 <- dat.r2[order(d),] >write.table(dat.r2,file="dat_rma.txt",sep="\t",quote=F,col.names=NA) >x95A.r2 <- exprs(x95A.rma) >d <- dimnames(x95A.r2)[[1]] >x95A.r2 <- x95A.r2[order(d),] >write.table(x95A.r2,file="x95A_rma.txt",sep="\t",quote=F,col.names=NA ) >x95Av2.r2 <- exprs(x95Av2.rma) >d <- dimnames(x95Av2.r2)[[1]] >x95Av2.r2 <- x95Av2.r2[order(d),] >write.table(x95Av2.r2,file="x95Av2_rma.txt",sep="\t",quote=F,col.name s=NA) The following 25 probe sets are on U95Av2 but NOT on U95A: >unlist(setdiff(dimnames(x95Av2.r2)[[1]],dimnames(x95A.r2)[[1]])) [1] "160020_at" "160021_r_at" "160022_at" "160023_at" "160024_at" [6] "160025_at" "160026_at" "160027_s_at" "160028_s_at" "160029_at" [11] "160030_at" "160031_at" "160032_at" "160033_s_at" "160034_s_at" [16] "160035_at" "160036_at" "160037_at" "160038_s_at" "160039_at" [21] "160040_at" "160041_at" "160042_s_at" "160043_at" "160044_g_at" The following 26 probe sets are on U95A but NOT on U95Av2: >unlist(setdiff(dimnames(x95A.r2)[[1]],dimnames(x95Av2.r2)[[1]])) [1] "119_at" "1215_at" "1216_at" "124_i_at" "125_r_at" "127_at" [7] "1301_s_at" "1302_s_at" "132_at" "1429_at" "1502_s_at" "1829_at" [13] "1864_at" "1889_s_at" "1982_s_at" "36969_at" "383_at" "397_at" [19] "412_s_at" "426_at" "439_at" "787_at" "788_s_at" "972_s_at" [25] "985_s_at" "997_at" This is corrrect, since I checked this also manually! Thus alltogether 51 probe sets which are not on both chips, should be eliminated by function combineAffyBatch(). Is this correct? However, these are the differences between the combined table and U95Av2: >unlist(setdiff(dimnames(x95Av2.r2)[[1]],dimnames(dat.r2)[[1]])) [1] "1142_at" "1143_s_at" "1144_at" "1145_g_at" "1146_at" [6] "1147_at" "1148_s_at" "1149_at" "1150_at" "1151_at" [11] "1162_g_at" "1163_at" "1164_at" "1170_at" "1171_s_at" [16] "1172_at" "1173_g_at" "1174_at" "1175_s_at" "1176_at" [21] "1177_at" "1178_at" "1179_at" "1180_g_at" "1181_at" [26] "1278_at" "1279_s_at" "1280_i_at" "1281_f_at" "1282_s_at" [31] "1283_at" "1284_at" "1285_at" "1286_s_at" "1428_at" [36] "1513_at" "1514_g_at" "1515_at" "1516_g_at" "160020_at" [41] "160021_r_at" "160022_at" "160023_at" "160024_at" "160025_at" [46] "160026_at" "160027_s_at" "160028_s_at" "160029_at" "160030_at" [51] "160031_at" "160032_at" "160033_s_at" "160034_s_at" "160035_at" [56] "160036_at" "160037_at" "160038_s_at" "160039_at" "160040_at" [61] "160041_at" "160042_s_at" "160043_at" "160044_g_at" "1608_at" [66] "1609_g_at" "1623_s_at" "1624_at" "1625_at" "1626_at" [71] "1627_at" "1628_at" "1629_s_at" "1630_s_at" "1631_at" [76] "1632_at" "1661_i_at" "1662_r_at" "1663_at" "1664_at" [81] "1665_s_at" "1725_s_at" "1726_at" "1743_s_at" "1744_at" [86] "1745_at" "1746_s_at" "1790_s_at" "1812_s_at" "1813_at" [91] "1818_at" "1819_at" "1820_g_at" "1821_at" "1822_at" [96] "1823_g_at" "1837_at" "1838_g_at" "1839_at" "1840_g_at" [101] "1841_s_at" "1842_at" "1843_at" "1876_at" "1877_g_at" [106] "1881_at" "1882_g_at" "1883_s_at" "1892_s_at" "1893_s_at" [111] "1894_f_at" "1903_at" "1905_s_at" "1906_at" "1921_at" [116] "1922_g_at" "1936_s_at" "1937_at" "292_s_at" "293_at" [121] "294_s_at" "295_s_at" "296_at" "297_g_at" "298_at" [126] "299_i_at" "300_f_at" "301_at" "302_at" "303_at" [131] "304_at" "305_g_at" "311_s_at" "312_s_at" "313_at" [136] "323_at" "324_f_at" "325_s_at" "326_i_at" "327_f_at" [141] "328_at" "329_s_at" "330_s_at" "331_at" "332_at" [146] "333_s_at" "334_s_at" "335_r_at" "693_g_at" "694_at" [151] "695_at" "696_at" "697_f_at" "698_f_at" "699_s_at" [156] "700_s_at" "701_s_at" "702_f_at" "703_at" "704_at" [161] "705_at" "706_at" "707_s_at" "711_at" "712_s_at" [166] "713_at" "714_at" "723_s_at" "724_at" "725_i_at" [171] "726_f_at" "727_at" "728_at" "729_i_at" "730_r_at" [176] "731_f_at" "732_f_at" "733_at" "734_at" "735_s_at" [181] "918_at" "919_at" "920_at" "921_s_at" "936_s_at" [186] "937_at" "938_at" "939_at" "952_at" "953_g_at" [191] "954_s_at" "955_at" "956_at" "957_at" "958_s_at" [196] "959_at" "960_g_at" and these are the differences between the combined table and U95A: >unlist(setdiff(dimnames(x95A.r2)[[1]],dimnames(dat.r2)[[1]])) [1] "1142_at" "1143_s_at" "1144_at" "1145_g_at" "1146_at" "1147_at" [7] "1148_s_at" "1149_at" "1150_at" "1151_at" "1162_g_at" "1163_at" [13] "1164_at" "1170_at" "1171_s_at" "1172_at" "1173_g_at" "1174_at" [19] "1175_s_at" "1176_at" "1177_at" "1178_at" "1179_at" "1180_g_at" [25] "1181_at" "119_at" "1215_at" "1216_at" "124_i_at" "125_r_at" [31] "1278_at" "1279_s_at" "127_at" "1280_i_at" "1281_f_at" "1282_s_at" [37] "1283_at" "1284_at" "1285_at" "1286_s_at" "1301_s_at" "1302_s_at" [43] "132_at" "1428_at" "1429_at" "1502_s_at" "1513_at" "1514_g_at" [49] "1515_at" "1516_g_at" "1608_at" "1609_g_at" "1623_s_at" "1624_at" [55] "1625_at" "1626_at" "1627_at" "1628_at" "1629_s_at" "1630_s_at" [61] "1631_at" "1632_at" "1661_i_at" "1662_r_at" "1663_at" "1664_at" [67] "1665_s_at" "1725_s_at" "1726_at" "1743_s_at" "1744_at" "1745_at" [73] "1746_s_at" "1790_s_at" "1812_s_at" "1813_at" "1818_at" "1819_at" [79] "1820_g_at" "1821_at" "1822_at" "1823_g_at" "1829_at" "1837_at" [85] "1838_g_at" "1839_at" "1840_g_at" "1841_s_at" "1842_at" "1843_at" [91] "1864_at" "1876_at" "1877_g_at" "1881_at" "1882_g_at" "1883_s_at" [97] "1889_s_at" "1892_s_at" "1893_s_at" "1894_f_at" "1903_at" "1905_s_at" [103] "1906_at" "1921_at" "1922_g_at" "1936_s_at" "1937_at" "1982_s_at" [109] "292_s_at" "293_at" "294_s_at" "295_s_at" "296_at" "297_g_at" [115] "298_at" "299_i_at" "300_f_at" "301_at" "302_at" "303_at" [121] "304_at" "305_g_at" "311_s_at" "312_s_at" "313_at" "323_at" [127] "324_f_at" "325_s_at" "326_i_at" "327_f_at" "328_at" "329_s_at" [133] "330_s_at" "331_at" "332_at" "333_s_at" "334_s_at" "335_r_at" [139] "36969_at" "383_at" "397_at" "426_at" "439_at" "693_g_at" [145] "694_at" "695_at" "696_at" "697_f_at" "698_f_at" "699_s_at" [151] "700_s_at" "701_s_at" "702_f_at" "703_at" "704_at" "705_at" [157] "706_at" "707_s_at" "711_at" "712_s_at" "713_at" "714_at" [163] "723_s_at" "724_at" "725_i_at" "726_f_at" "727_at" "728_at" [169] "729_i_at" "730_r_at" "731_f_at" "732_f_at" "733_at" "734_at" [175] "735_s_at" "787_at" "788_s_at" "918_at" "919_at" "920_at" [181] "921_s_at" "936_s_at" "937_at" "938_at" "939_at" "952_at" [187] "953_g_at" "954_s_at" "955_at" "956_at" "957_at" "958_s_at" [193] "959_at" "960_g_at" "972_s_at" "985_s_at" "997_at" Can anybody tell me if there is a mistake in my code or why function combineAffyBatch() deletes the wrong probe sets? Best regards Christian