I ran the following code:
mySequences <- readAAStringSet("batch_1.fa")
myFirstAlignment <- msaClustalOmega(mySequences)
msaPrettyPrint(myFirstAlignment, output=c("pdf", "tex", "dvi", "asis"))
msaPrettyPrint(myFirstAlignment, output="asis", alFile = "/Users//Desktop/alignment.fasta")
batch_1.fasta file looks like this:
>CLocus_1_Sample_243_Locus_1_Allele_0 [BC-B39.all]
TGCAGGGTAGACTCATGGATGATAGGCATCTTCTATCCCATTTTTGTTTTTTTTAGGCATCATTTATCTCTAAGC
The output fasta file alignment.fasta look like this:
>CLocus_2130_Sample_581_Locus_940_Allele_0 [BC_30_2.all]
---------------------------AA-------------TTCAGGTA----AA--------------------TTTT
TTA-----------G-A---A-----------------------------------------------------------
--------------------------------------------------------------------------------
--------------------------------------------------------------------------------
-------------------G----TGGTC---CCA---------------------------------------------
------------------AT-TCGTT---------------T--------------------------------------
--------------------------------------C-----------------------------------------
----------------------------------------AC-------A-ACAG-------------------------
------------------------------------------------AAATTA-----------ATCAA-----CCA--
----A--ATA---------------------------------------------TT-----------------------
------TT-T---------
I got out the alignment file in a fasta to run in RAxML. The problem is the populations do not appear to be defined in the alignment file so that when RAxML goes to make a tree it uses populations instead of every locus.
Sorry, but I don't get the question. I don't know RAxML, but it seems this is not an 'msa' issue, but a matter of how RAxML expects information about populations. Once you have found that out, you can simply change the sequence names in the FASTA file containing the alignment (if that is what RAxML expects).